ID: 1141840660

View in Genome Browser
Species Human (GRCh38)
Location 16:86572204-86572226
Sequence CCACCCAGCCAAAACCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141840660_1141840664 17 Left 1141840660 16:86572204-86572226 CCTGGCGGGTTTTGGCTGGGTGG No data
Right 1141840664 16:86572244-86572266 AGTCCGGTTATGACAGATATGGG No data
1141840660_1141840662 1 Left 1141840660 16:86572204-86572226 CCTGGCGGGTTTTGGCTGGGTGG No data
Right 1141840662 16:86572228-86572250 TTCTGACTCTAAGCACAGTCCGG No data
1141840660_1141840666 25 Left 1141840660 16:86572204-86572226 CCTGGCGGGTTTTGGCTGGGTGG No data
Right 1141840666 16:86572252-86572274 TATGACAGATATGGGCCACCCGG No data
1141840660_1141840663 16 Left 1141840660 16:86572204-86572226 CCTGGCGGGTTTTGGCTGGGTGG No data
Right 1141840663 16:86572243-86572265 CAGTCCGGTTATGACAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141840660 Original CRISPR CCACCCAGCCAAAACCCGCC AGG (reversed) Intergenic