ID: 1141840663 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:86572243-86572265 |
Sequence | CAGTCCGGTTATGACAGATA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1141840659_1141840663 | 17 | Left | 1141840659 | 16:86572203-86572225 | CCCTGGCGGGTTTTGGCTGGGTG | No data | ||
Right | 1141840663 | 16:86572243-86572265 | CAGTCCGGTTATGACAGATATGG | No data | ||||
1141840660_1141840663 | 16 | Left | 1141840660 | 16:86572204-86572226 | CCTGGCGGGTTTTGGCTGGGTGG | No data | ||
Right | 1141840663 | 16:86572243-86572265 | CAGTCCGGTTATGACAGATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1141840663 | Original CRISPR | CAGTCCGGTTATGACAGATA TGG | Intergenic | ||