ID: 1141841125

View in Genome Browser
Species Human (GRCh38)
Location 16:86574786-86574808
Sequence CCCAGAGCACCCACTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141841117_1141841125 27 Left 1141841117 16:86574736-86574758 CCAGACAATCTCTGCCTCTGAGT No data
Right 1141841125 16:86574786-86574808 CCCAGAGCACCCACTTTTGGAGG No data
1141841120_1141841125 0 Left 1141841120 16:86574763-86574785 CCAGATACCTGAGCATGTCAGAC No data
Right 1141841125 16:86574786-86574808 CCCAGAGCACCCACTTTTGGAGG No data
1141841118_1141841125 13 Left 1141841118 16:86574750-86574772 CCTCTGAGTCCTTCCAGATACCT No data
Right 1141841125 16:86574786-86574808 CCCAGAGCACCCACTTTTGGAGG No data
1141841119_1141841125 4 Left 1141841119 16:86574759-86574781 CCTTCCAGATACCTGAGCATGTC No data
Right 1141841125 16:86574786-86574808 CCCAGAGCACCCACTTTTGGAGG No data
1141841121_1141841125 -7 Left 1141841121 16:86574770-86574792 CCTGAGCATGTCAGACCCCAGAG No data
Right 1141841125 16:86574786-86574808 CCCAGAGCACCCACTTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141841125 Original CRISPR CCCAGAGCACCCACTTTTGG AGG Intergenic
No off target data available for this crispr