ID: 1141841455

View in Genome Browser
Species Human (GRCh38)
Location 16:86576730-86576752
Sequence GGCCGCGCCCGCCTAGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141841455_1141841469 25 Left 1141841455 16:86576730-86576752 CCAGGACCTAGGCGGGCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1141841469 16:86576778-86576800 AGGAGCAGGGCCGCGGAGGGAGG 0: 1
1: 0
2: 2
3: 57
4: 637
1141841455_1141841468 22 Left 1141841455 16:86576730-86576752 CCAGGACCTAGGCGGGCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1141841468 16:86576775-86576797 TAGAGGAGCAGGGCCGCGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 158
1141841455_1141841461 5 Left 1141841455 16:86576730-86576752 CCAGGACCTAGGCGGGCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1141841461 16:86576758-86576780 GCTCGCTGGACCCACGTTAGAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1141841455_1141841462 11 Left 1141841455 16:86576730-86576752 CCAGGACCTAGGCGGGCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1141841462 16:86576764-86576786 TGGACCCACGTTAGAGGAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
1141841455_1141841467 21 Left 1141841455 16:86576730-86576752 CCAGGACCTAGGCGGGCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1141841467 16:86576774-86576796 TTAGAGGAGCAGGGCCGCGGAGG 0: 1
1: 0
2: 1
3: 14
4: 134
1141841455_1141841459 -9 Left 1141841455 16:86576730-86576752 CCAGGACCTAGGCGGGCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1141841459 16:86576744-86576766 GGCGCGGCCGGGCTGCTCGCTGG 0: 1
1: 0
2: 2
3: 33
4: 213
1141841455_1141841463 12 Left 1141841455 16:86576730-86576752 CCAGGACCTAGGCGGGCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1141841463 16:86576765-86576787 GGACCCACGTTAGAGGAGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 81
1141841455_1141841466 18 Left 1141841455 16:86576730-86576752 CCAGGACCTAGGCGGGCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1141841466 16:86576771-86576793 ACGTTAGAGGAGCAGGGCCGCGG 0: 1
1: 0
2: 1
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141841455 Original CRISPR GGCCGCGCCCGCCTAGGTCC TGG (reversed) Intronic
900205155 1:1428268-1428290 TCCCGCGCCTGCCCAGGTCCCGG + Intergenic
900554448 1:3272765-3272787 GGCCTCGCCCACCTTGTTCCAGG - Intronic
903184692 1:21622477-21622499 GCCCGCGCGCGCCCGGGTCCGGG + Intronic
903413774 1:23168103-23168125 GGCCGCGCCGGCCCGCGTCCCGG - Intronic
905775597 1:40665511-40665533 GTCCGCGCCAGCCTGGGGCCGGG - Exonic
907278141 1:53328124-53328146 GGCGGCGGCCGCCCAGGGCCGGG - Intergenic
912550655 1:110483333-110483355 GGGCGCTCCTGCCTGGGTCCTGG - Intergenic
912764397 1:112395989-112396011 GGAAGCGCCCTCCTGGGTCCTGG - Intergenic
915616826 1:157045754-157045776 GGCCGCGCTCGCCTCCTTCCGGG + Intergenic
921671110 1:217925066-217925088 GGCCGAGCGCGCCCAGGGCCTGG - Intergenic
922756948 1:228102118-228102140 GGCCGAGGCTGCCGAGGTCCCGG + Exonic
924383284 1:243482610-243482632 GGCCGCACCAGCCTGGGTGCAGG + Intronic
924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG + Intergenic
1063546881 10:6989718-6989740 AGCCTCGACCTCCTAGGTCCAGG - Intergenic
1067295885 10:44975075-44975097 GGCCCCGCCCGCCTGGGGCGCGG + Intronic
1067851700 10:49758921-49758943 GGGAGCACCCACCTAGGTCCTGG + Intronic
1069761689 10:70815901-70815923 GGCCGCGCACGCCAGGGTCCGGG + Intergenic
1075684682 10:124355210-124355232 GGCCCCGCCCTCCTCGGGCCAGG + Intergenic
1076096365 10:127737309-127737331 GGCCCCGCCCGGCCAGGCCCAGG + Exonic
1077253869 11:1572139-1572161 GGCCGCGCCCGCCGAGCCGCGGG - Intergenic
1081682929 11:45021571-45021593 GGCCACGTCTGCCCAGGTCCTGG + Intergenic
1083682808 11:64359118-64359140 GCCGGCGCCCGCCTCGGCCCCGG + Intergenic
1085640324 11:78189073-78189095 GGCTGGGCCCGGCTAGGTCAGGG - Exonic
1091672388 12:2461837-2461859 GGCCGCCCTCGCCTCCGTCCTGG + Intronic
1100315400 12:93441241-93441263 TGCCGCGGCTGCCTGGGTCCCGG - Intronic
1102101282 12:110281025-110281047 GGCCGCGCGCGCCGCGGTCGCGG - Intronic
1104897234 12:132170427-132170449 GGCCGCCCCCGCCCAGCACCAGG - Intergenic
1112290645 13:98142517-98142539 CCCCGCGCCCGCCCACGTCCTGG - Intergenic
1117867540 14:60165313-60165335 GGCCGCGCACGCCCAGCTCGGGG + Exonic
1122840884 14:104461995-104462017 CACCGCGCACGCCTAGGCCCCGG + Intergenic
1122982182 14:105196840-105196862 GGCCGCACCTGCCGAGGCCCAGG - Intergenic
1123048304 14:105528798-105528820 GGCCGCGCGCGCCCAGGCCGGGG + Exonic
1123494695 15:20814270-20814292 GGCCGCGCGCCCCAAGTTCCTGG - Intergenic
1123551190 15:21383363-21383385 GGCCGCGCGCCCCAAGTTCCTGG - Intergenic
1125589201 15:40844143-40844165 GGCCGGGTCCGCCGAGGTTCCGG - Exonic
1129676143 15:77633170-77633192 GGCCGCGCCCCTCCGGGTCCGGG + Intronic
1131068499 15:89449264-89449286 TGCAGCGCCCGCCTTTGTCCTGG - Intergenic
1202959532 15_KI270727v1_random:110606-110628 GGCCGCGCGCCCCAAGTTCCTGG - Intergenic
1132724738 16:1333829-1333851 GGCCGCCGCCCCCTTGGTCCGGG + Intronic
1135135536 16:19883877-19883899 GCCCGCACCCGCCTTGGCCCCGG - Intronic
1136267587 16:29130519-29130541 GGCAGCGCCCGCCCAGGCCTGGG + Intergenic
1136453910 16:30369991-30370013 GGCGCGGCCCGCCTGGGTCCCGG - Exonic
1136455632 16:30378326-30378348 GGCGGCACCCGCGGAGGTCCCGG + Exonic
1137676061 16:50304394-50304416 GGCCGCGTCCCCCTTGGGCCTGG - Exonic
1139890603 16:70251309-70251331 GCCCGCGCCCACCTGGCTCCTGG - Exonic
1141841455 16:86576730-86576752 GGCCGCGCCCGCCTAGGTCCTGG - Intronic
1142657045 17:1400990-1401012 CGCCGCGCCCGGCCAGGGCCCGG - Intergenic
1142990078 17:3724376-3724398 GGCCGCACACGCTGAGGTCCGGG - Exonic
1144756441 17:17682697-17682719 GGCCGCGACGGCCTAGGGCCTGG - Intronic
1147792932 17:43024779-43024801 TCCCGCGTCCGCCTATGTCCTGG - Intronic
1148865543 17:50626378-50626400 GCCAGCGCCGGCCTACGTCCTGG + Exonic
1150133111 17:62679936-62679958 GGCCCCGCCCACCAAGCTCCCGG - Intronic
1151727039 17:75891234-75891256 TGCCGGGCCCGCCTGGGCCCCGG + Exonic
1152049144 17:77958956-77958978 CGCCGCCGCCGCCTAGGACCCGG + Intergenic
1152362579 17:79839478-79839500 GGCCCCGCCCGCTGACGTCCGGG - Intergenic
1154501412 18:14999621-14999643 GCCCGCGCCCGCCTTGCTGCAGG - Intergenic
1156812904 18:41274079-41274101 GGCCCAGCCTGCCTATGTCCAGG + Intergenic
1160499179 18:79394113-79394135 GGCCGCCCCCGCCCCGGCCCCGG + Intergenic
1161483751 19:4523875-4523897 GGCCGCGCTGGCCGAGGGCCGGG - Exonic
1162554142 19:11375875-11375897 GGCCCAGCCCGCCTGGCTCCAGG - Exonic
1163688448 19:18725446-18725468 GGCCGAGGCCTCCTAGGTTCTGG - Intronic
1165938223 19:39402620-39402642 GGCCACGCCCGCTCAGGCCCAGG + Intergenic
1167007931 19:46787590-46787612 GGCCGAGCGCGCCGGGGTCCAGG + Exonic
1167208021 19:48115626-48115648 GCCCTCGCCCTCCTAGGGCCTGG - Exonic
1168345573 19:55648786-55648808 GGGCCCAGCCGCCTAGGTCCTGG - Exonic
932566910 2:72916441-72916463 GCCCGCGCCCTCCTAGGCCTCGG + Intronic
945225939 2:207530632-207530654 GGCAGCCGCCGCCTAGGTGCCGG + Intronic
947435460 2:230068520-230068542 GGCCGCGCGCGCCGCGGGCCTGG - Intronic
948942621 2:241203831-241203853 GGTCGCCCCTGCCTGGGTCCAGG + Intronic
1171011565 20:21512114-21512136 GGCCGTGCCCGTCTTGGTCAGGG - Exonic
1175804008 20:61817279-61817301 GGCCCAGCCCCGCTAGGTCCCGG + Intronic
1176868670 21:14070810-14070832 GGCCACGCCCGCCTGGCTCCAGG - Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1185391306 22:50562827-50562849 GGCCGCGCCCCCCTGGGCCCCGG - Intronic
949987787 3:9553582-9553604 GGCCGGGCCCGAGTAGGGCCGGG + Intronic
966917523 3:184593229-184593251 GGCAGCTCCCTCCTAGGTCATGG - Intronic
968506449 4:973364-973386 GGCCGCGCGCGCCCGGGGCCGGG - Exonic
968556344 4:1248201-1248223 GCCTGGGCCCGCCCAGGTCCCGG - Intronic
968764887 4:2463022-2463044 GGCCGGGCCCCCCTCGGCCCCGG + Intronic
972396846 4:38664748-38664770 GGCAGCGCCCGCCGCCGTCCCGG + Intronic
973931070 4:55793690-55793712 GGCCGCGCCCGCCCGGGGCGAGG - Intergenic
978748552 4:112222523-112222545 GGCAGCGCCCGCCAAGCGCCGGG - Intergenic
985692178 5:1319572-1319594 GGCGGGTCCTGCCTAGGTCCGGG - Intronic
985730516 5:1544805-1544827 GGCTGCGCCCGCTTACTTCCAGG - Intergenic
992549117 5:77844811-77844833 GGACGCCCCCGCCCTGGTCCCGG + Intronic
992866364 5:80960638-80960660 GGGCGCGACCGCTCAGGTCCCGG - Intergenic
997292310 5:132747116-132747138 GACTGCGCCCGCCTTGGGCCAGG - Intergenic
998286905 5:140871139-140871161 CGCGGCGCCCGCCAAAGTCCGGG - Exonic
1001950947 5:175816106-175816128 GGCGGAGCCGGCCTAGATCCCGG - Intronic
1008760445 6:54846852-54846874 GGTCCCGTCCGCCGAGGTCCGGG - Intronic
1010083249 6:71887309-71887331 GGAGGCGCCCGCCTTGGGCCAGG + Intronic
1013793613 6:113860188-113860210 GGCCGCGCCCGCCTCGGCGGCGG - Exonic
1014798320 6:125749668-125749690 AGCCGCGCCTGCCCAGGCCCGGG + Exonic
1017146502 6:151240213-151240235 CGACGCGCCAGCCCAGGTCCAGG - Intronic
1019279652 7:193364-193386 GGCCGCGCCCGGCTGGGCCCAGG + Exonic
1019303685 7:322363-322385 GGCCACGCCCCCCGAGGCCCAGG + Intergenic
1020046679 7:5045973-5045995 CCCCGCGCCCGCCTAGGTGCTGG - Exonic
1020125445 7:5530463-5530485 GGCCGCGGCCGCCTGCGGCCGGG + Intronic
1020292050 7:6729894-6729916 CTCCGCGCCCGCCTAGGTGCTGG - Intergenic
1024359830 7:48456004-48456026 GGCCGTGCCCGGCAAGGGCCGGG - Intronic
1025615687 7:63114347-63114369 GGCCGCGCACGCCCAGGGGCTGG + Intergenic
1026727236 7:72879470-72879492 GCTCCCGCCCGCCTAGGTGCTGG - Exonic
1027116593 7:75486164-75486186 GCTCCCGCCCGCCTAGGTGCTGG + Exonic
1027121919 7:75527986-75528008 CTCCGCGTCCGCCTAGGTGCTGG + Intergenic
1027275208 7:76549446-76549468 GCTCCCGCCCGCCTAGGTGCTGG - Intergenic
1028585608 7:92448016-92448038 GTCCCCGCCCGCCTAGCACCTGG - Intronic
1029720916 7:102363996-102364018 GCTCCCGCCCGCCTAGGTGCTGG - Exonic
1031997227 7:128240863-128240885 GGCTGCGCCCTCGTTGGTCCTGG - Intergenic
1032406022 7:131656049-131656071 GGCCCTGGCCTCCTAGGTCCAGG - Intergenic
1034162859 7:149005595-149005617 GGCCACGCCTGCCTGGGGCCAGG + Intronic
1034951206 7:155298021-155298043 GCCCGCGCCCGCCTACCTCCGGG - Intronic
1035432129 7:158829888-158829910 GGCTGCGCTCGCCGAGGCCCGGG + Intronic
1037977654 8:23224820-23224842 TCCCGCGCCGGCCTGGGTCCTGG + Exonic
1044823748 8:96177381-96177403 GGCCAGGCCAGCCTGGGTCCTGG - Intergenic
1049409210 8:142464954-142464976 CGCCGTGCCCGCCCCGGTCCTGG - Exonic
1049643161 8:143724649-143724671 GGCCGAGCCCAACTAGGTCCTGG - Exonic
1058937181 9:109780201-109780223 GGCCGCGCCAGCCGAGGACGTGG - Intronic
1061457879 9:130712596-130712618 GGCCCCGCCCTCCTGGGACCTGG - Intergenic
1061540738 9:131276925-131276947 CGCCGCGGCCGCCGAGGACCTGG + Intergenic
1062164871 9:135102601-135102623 GGCCGCCCCAGCCCAGGCCCTGG + Intronic
1062277811 9:135739014-135739036 GGGCAAGGCCGCCTAGGTCCAGG - Intronic
1203771974 EBV:54100-54122 GGCCGAGGCGGCCGAGGTCCGGG - Intergenic
1189333256 X:40155551-40155573 GCCCGCTCCCGTCTGGGTCCGGG - Intronic
1196684069 X:118495886-118495908 GGCCGCGGCCGCCGCGGGCCGGG + Intronic