ID: 1141842442

View in Genome Browser
Species Human (GRCh38)
Location 16:86581946-86581968
Sequence TGTTTGTATGTTATCTTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141842438_1141842442 18 Left 1141842438 16:86581905-86581927 CCGTATTGAATCGGTTTTTAATC 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1141842442 16:86581946-86581968 TGTTTGTATGTTATCTTGGGAGG 0: 1
1: 0
2: 0
3: 19
4: 335
1141842439_1141842442 -8 Left 1141842439 16:86581931-86581953 CCTTTTTCTTTTTTGTGTTTGTA 0: 1
1: 3
2: 19
3: 466
4: 5721
Right 1141842442 16:86581946-86581968 TGTTTGTATGTTATCTTGGGAGG 0: 1
1: 0
2: 0
3: 19
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141842442 Original CRISPR TGTTTGTATGTTATCTTGGG AGG Exonic
900543084 1:3213761-3213783 TGTTTGTAGGTGACCTGGGGTGG - Intronic
903448055 1:23434994-23435016 TGTCTGTCTGATATCTTGGTGGG - Intronic
903691159 1:25174616-25174638 TGTTTTTATGTTAGCCTTGGGGG - Intergenic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
903946293 1:26965828-26965850 TGTTTGTTTGTTTTGTAGGGAGG - Intergenic
906782594 1:48585806-48585828 TGTTTGTATGTGTGTTTGGGAGG - Intronic
909241254 1:73216803-73216825 TGTAAGTATGAAATCTTGGGGGG - Intergenic
909850826 1:80461655-80461677 TGTTTGTAAGCTATCTTTTGGGG - Intergenic
910324422 1:85989105-85989127 TGTTAGTATGTTTTTTTGTGGGG + Intronic
912145421 1:106788101-106788123 TGTTTATATGTTATACAGGGAGG - Intergenic
912360923 1:109094274-109094296 TGTTTTTATTTTATTTTTGGAGG - Intronic
913507552 1:119531875-119531897 TGTCTGCCAGTTATCTTGGGTGG - Intergenic
913514680 1:119594310-119594332 TGTTTGTCAGTTATTTTTGGGGG - Intergenic
916032449 1:160889743-160889765 AGTTTGTATTTCATCTTGAGTGG + Intergenic
917024723 1:170629913-170629935 TGTTTGTTTGTTTGTTTGGGAGG + Intergenic
917849967 1:179053439-179053461 TGTTTGTTTGTTTGTTTGGGTGG - Intronic
919089463 1:192960984-192961006 TGTTTGTTTGTTTTTTTGAGAGG + Intergenic
919208261 1:194446354-194446376 TGTTTGTATGTTTTCTTTTCTGG + Intergenic
920263343 1:204704405-204704427 TGTTTGTGTGTTTTCTTTGACGG + Intergenic
920306536 1:205021753-205021775 TGTTTGTCTTTCATTTTGGGAGG - Exonic
921236316 1:213135111-213135133 TTTTTGTATGTTCTCTTGCAGGG + Intronic
921376968 1:214484592-214484614 TATTTATATGTTGTGTTGGGGGG - Intronic
921901837 1:220459300-220459322 TGTTTGTATCTTATTTGGGAAGG + Intergenic
922797262 1:228346501-228346523 TGTTTCTATGTCAGCCTGGGAGG + Intronic
923026333 1:230207398-230207420 TGTTTGTCTGTTTGTTTGGGAGG - Intronic
923388400 1:233489004-233489026 TGTCTGTATGTATTCATGGGTGG - Intergenic
924813277 1:247421801-247421823 TGTTTGTTTGTTTCCTGGGGTGG + Intronic
1063449878 10:6144410-6144432 TTTTTGTTTGTTGTTTTGGGGGG - Intergenic
1063689928 10:8277238-8277260 TGTTTTTATACTATCTTGAGTGG + Intergenic
1063748297 10:8912325-8912347 TGTTTGTTTGTTTTCTTGGAAGG - Intergenic
1065038492 10:21665284-21665306 TGTTTGTTTGTTTTTTTTGGGGG + Intronic
1066403759 10:35099740-35099762 TTTTTTTATTTTATTTTGGGTGG - Intergenic
1066569090 10:36752083-36752105 TGTTTGTTTGTTTTTTTGAGAGG - Intergenic
1066611350 10:37251356-37251378 TGTTTCTATGCTTTTTTGGGAGG - Intronic
1070234688 10:74611193-74611215 TTTTTGTATTTTTTCTTTGGTGG + Intronic
1071073245 10:81719818-81719840 TGTTTGTTTTTTATCTTGAAAGG - Intergenic
1072055266 10:91748909-91748931 TGTTTTTATCTTAATTTGGGTGG + Intergenic
1073172225 10:101520142-101520164 TGTTTGTTTGTTTGTTTGGGGGG + Intronic
1073959519 10:108910703-108910725 TGTTCGTTTGTTTTCTTGGCGGG - Intergenic
1076438280 10:130461303-130461325 TGCTTGTCTGTTATCTCGTGTGG - Intergenic
1077372107 11:2187348-2187370 TGTTTGTATGTGATGTGGTGTGG - Intergenic
1078000972 11:7495337-7495359 TCTTTATATGTTATTTTTGGGGG - Intronic
1078983968 11:16571619-16571641 TGTTTGTTTGTTTGTTTGGGGGG + Intronic
1079449895 11:20591271-20591293 TATTTTTATGTTTTCTTGGGGGG + Intergenic
1079582590 11:22084612-22084634 TGTTTGTTTGTTTGTTTGGGGGG + Intergenic
1079698792 11:23518464-23518486 TGTCTGCATGTTGTTTTGGGGGG - Intergenic
1079862807 11:25694890-25694912 AGTTTGTATGTTATTCTGAGAGG - Intergenic
1080105301 11:28505470-28505492 TGTTTGTTTGTTTTAATGGGCGG - Intergenic
1080831809 11:35901062-35901084 TGTATGTATGTATTTTTGGGGGG - Intergenic
1084343928 11:68530430-68530452 TTCTTGTGTGTTTTCTTGGGTGG + Intronic
1086122934 11:83319057-83319079 TGCTTGTATCTTATCTTTTGAGG - Intergenic
1086236354 11:84635783-84635805 TCTTAGTATGTGATCTTGGTGGG - Intronic
1086931818 11:92701864-92701886 TGTTTTTTTGTTGTTTTGGGTGG + Intronic
1087747951 11:101971559-101971581 TGTTTGTTTGTTTTTTTAGGTGG + Intronic
1087875411 11:103350016-103350038 TGTTGGTATGTAGTTTTGGGGGG + Intronic
1089098932 11:115944171-115944193 TGTTTGTTTATTAACTTGAGAGG + Intergenic
1089250396 11:117155858-117155880 TTTTTGTTTGCTATTTTGGGGGG - Intronic
1090143058 11:124286346-124286368 TGTCTGTATATTTTCTTTGGTGG + Intergenic
1091766336 12:3122463-3122485 TGTTTGTATGTTGTCCAGGCTGG + Intronic
1094165506 12:27438780-27438802 TGTTTGTTTGTTTTTTTGTGGGG - Intergenic
1094284276 12:28774906-28774928 GGTTTGTATATTTTCTTGGCTGG + Intergenic
1094458530 12:30667101-30667123 TGTTTGTATTTTATATTTTGAGG - Intronic
1095275789 12:40281101-40281123 TGTTTGTTTGTTTTGTTGGTTGG - Intronic
1095428322 12:42103741-42103763 TGGTTGTATGTTAATTTGGCAGG - Intronic
1098056148 12:66507525-66507547 AGTTTGTATTTTATTTTGGGGGG - Intronic
1098335402 12:69399145-69399167 TGTTTGTTTGTTTTTTTGGGGGG - Intergenic
1098540220 12:71647434-71647456 TTTTTGTGTGTTATCCTGTGTGG - Intronic
1098554382 12:71802220-71802242 TGTTTGTATTTTTTTTTGCGGGG + Intergenic
1099331307 12:81292186-81292208 TGTTTGCATTTGCTCTTGGGAGG + Intronic
1100117908 12:91331112-91331134 TTTTTTTCTGTTATGTTGGGTGG + Intergenic
1100525759 12:95418159-95418181 TGTTTGTTTGTTTTATTGGTTGG - Intergenic
1100928008 12:99571916-99571938 TGTTTGTTTGTTTATTTGGGGGG - Intronic
1101750322 12:107578105-107578127 TATTTGTATGTTTTCTTTGGAGG - Intronic
1102121790 12:110447798-110447820 TGTTTGTTTGTTTTTTTGGGGGG - Intronic
1104399154 12:128461424-128461446 TGTTTGTTTGTTTTTGTGGGTGG - Intronic
1107300873 13:38964361-38964383 TGTCTGTTTGTTTTCTGGGGTGG - Intergenic
1108000590 13:45902378-45902400 TGTTTGTTTGTTTTTTTAGGTGG + Intergenic
1108082734 13:46754027-46754049 TGTGTGTATTTTATGTGGGGTGG - Intergenic
1108745984 13:53394728-53394750 TGTGTGTATGTTTCTTTGGGAGG + Intergenic
1110534933 13:76639933-76639955 TGTTTGTCTGTTTTCTTGAGTGG - Intergenic
1110557934 13:76882027-76882049 TATTTGAATGGTATCTTTGGAGG + Exonic
1110583397 13:77158791-77158813 GGTGTGTCTGTTCTCTTGGGTGG + Intronic
1112310657 13:98314865-98314887 TGTATGTATGTATTGTTGGGAGG + Intronic
1113047039 13:106167601-106167623 TGTTTGTATGTGAGGTTGTGTGG - Intergenic
1114005505 14:18308787-18308809 TGTTTTTATGTTATGTTAGCAGG - Intergenic
1115791820 14:36888086-36888108 TGTTTGTCTGTTTTCCAGGGAGG + Intronic
1116301044 14:43183886-43183908 TCTTCGTATGTTGTCTAGGGTGG - Intergenic
1116791588 14:49345533-49345555 ATTTTCTATGTTAACTTGGGTGG - Intergenic
1117937573 14:60924242-60924264 TGTTTGTTTGTTTGCTTTGGGGG + Intronic
1118513746 14:66505090-66505112 TTTTTTTATGTTGTCTTGGATGG + Intergenic
1118892079 14:69918879-69918901 GGGTTGTATGTGATCTTGTGAGG - Intronic
1119120598 14:72072608-72072630 TGTTTGTGTTTTATATTAGGAGG + Intronic
1121656437 14:95599839-95599861 TTTATGTGTGTTATCTTGTGGGG + Intergenic
1123787190 15:23686029-23686051 TGTTTATATGTAAGCTTGGTTGG - Exonic
1125860677 15:42996607-42996629 TTTTTGTTTGTTTTGTTGGGGGG - Intronic
1126129006 15:45322673-45322695 TATATGTATGTTATATGGGGTGG - Intergenic
1126129033 15:45322969-45322991 TGTGTGTGTGTTATATGGGGTGG + Intergenic
1126353775 15:47772847-47772869 TTTTTGTTTCTTACCTTGGGGGG - Exonic
1126701255 15:51369918-51369940 TCTTTCTATGTTATCTAGGCTGG - Intronic
1129926142 15:79365937-79365959 TGTTAAGATGTTATCTTGTGTGG + Intronic
1131168504 15:90160008-90160030 TGTTTGTTTGTTTTTTTGCGGGG + Intergenic
1131530473 15:93186915-93186937 TGTTTGTATATTTTCTTTTGAGG + Intergenic
1131944196 15:97601171-97601193 TTTTTGCATGTTATCTAGAGAGG - Intergenic
1133140760 16:3742116-3742138 TTTTTGTTTGTTTTTTTGGGGGG - Intronic
1135390163 16:22085912-22085934 TCTTGAAATGTTATCTTGGGTGG - Intronic
1135811001 16:25586666-25586688 TGTTTGTATGGGAACTTGGACGG + Intergenic
1136521125 16:30796544-30796566 TGTTTGTTTGTTTTCTTTGTAGG + Intergenic
1138226567 16:55300727-55300749 TGTTTGTTTGTTGCCTTAGGGGG + Intergenic
1138606345 16:58091973-58091995 TGTTACTATGTTTTTTTGGGGGG - Intergenic
1138622790 16:58225153-58225175 TGTTTGTTTGTTTTTTTGGGGGG - Intergenic
1138892944 16:61167275-61167297 TGTTTGGAGGTTATCTTTGCTGG - Intergenic
1138927562 16:61611005-61611027 AGTTTGAACTTTATCTTGGGTGG + Intergenic
1139175895 16:64687191-64687213 TGTTTGTACTTAATCTTGGCTGG + Intergenic
1140576750 16:76179734-76179756 TTTTTCTATTTTATTTTGGGGGG - Intergenic
1140659840 16:77178077-77178099 CATTTGTATGTTTTCTTTGGAGG + Intergenic
1141723993 16:85774175-85774197 TGTCAGTATGTTGTCTAGGGTGG + Intronic
1141842442 16:86581946-86581968 TGTTTGTATGTTATCTTGGGAGG + Exonic
1143576982 17:7799454-7799476 TGTTTGTTTGTTTTGGTGGGTGG + Intronic
1143805598 17:9423744-9423766 TGTTTTTCTTTTATCTTTGGAGG - Intronic
1144110150 17:12022555-12022577 TGTTTGTTTGTTTTATTGGTGGG + Intronic
1146763580 17:35498816-35498838 TGTTAGTCTGTTGTCTTGGCAGG - Intronic
1146806531 17:35869206-35869228 TGTTTGTTTGTTTGTTTGGGAGG + Intergenic
1147271230 17:39273042-39273064 TGTTTGTTTGTTTTTTTGAGAGG + Intronic
1147321848 17:39651400-39651422 TGTTTGTCCCTGATCTTGGGAGG - Intronic
1150332844 17:64308240-64308262 TGTTTGTTTGTTTTTTGGGGGGG - Intergenic
1151928332 17:77214754-77214776 TTTCTGTATGTGAACTTGGGTGG + Intronic
1152653138 17:81505674-81505696 TGTTTGTCTGTTTTTTTGGGGGG - Intergenic
1152980310 18:269981-270003 TGTCTGTATGTGGTCTTGGCTGG + Intergenic
1153046235 18:857764-857786 TGTGTGTATGTGTTTTTGGGGGG - Intergenic
1153134340 18:1896788-1896810 TGTATTTATGTTATTTTAGGGGG + Intergenic
1153192331 18:2555790-2555812 TGTTTGTTTGTTTTGTTGGTTGG + Intronic
1153772550 18:8427218-8427240 TGTTTGTTTTTTATCTTTAGAGG + Intergenic
1154531926 18:15355097-15355119 TGTTTTTATGTTATGTTAGCAGG + Intergenic
1156219039 18:35032803-35032825 TGTTTGTTTTTTATTTTTGGTGG + Intronic
1157290231 18:46404806-46404828 TGTTTGTTTGTTTTGGTGGGGGG - Intronic
1158072083 18:53483589-53483611 TGTTTGTATGTTAATCTGTGGGG - Intronic
1158141985 18:54265664-54265686 TGTCTGTATTTTATGTTGGTGGG - Intergenic
1158365740 18:56733413-56733435 TGTTTGTTTTTTACTTTGGGTGG - Intronic
1158380359 18:56923102-56923124 TGTTTGTTTGTTTTTTTGAGGGG - Intronic
1158435292 18:57430998-57431020 TGTTTGTTTGTTTTTCTGGGTGG - Intergenic
1159241394 18:65748361-65748383 TGTTTATATTTTATCTTAGGAGG - Intergenic
1159578123 18:70204864-70204886 TGTTTTTGAGTTATCTTTGGAGG - Intronic
1163634109 19:18430519-18430541 TGTGTGTATGTTTATTTGGGGGG + Intronic
1164306579 19:24009162-24009184 TGTTTGTTTGTTTTGTGGGGAGG - Intergenic
1164390143 19:27812909-27812931 TGTTTGTTTGTTTTTTTGAGTGG - Intergenic
1166671651 19:44713582-44713604 AGTTTTTATGTGAACTTGGGTGG - Intergenic
1167411024 19:49343839-49343861 TGTTTGTCTTTTTTTTTGGGGGG + Intronic
1167920684 19:52780723-52780745 TGTTTGTTTGTTTTTTTGAGAGG - Intronic
1168013445 19:53553497-53553519 TGTTTGGAGATTATCTTGTGTGG - Intronic
1168173134 19:54603059-54603081 TGTTTGTATTTTATATTGTTTGG - Intronic
1168305139 19:55431139-55431161 TGTTTGAATGAAATCCTGGGAGG + Exonic
925210060 2:2037783-2037805 TGTTTTTTTGTTTTTTTGGGGGG - Intronic
925395093 2:3527779-3527801 TGTATGTATGGTATGTTGTGTGG + Intergenic
925679280 2:6400869-6400891 TGTTTGTTTGTTTTGTTGAGAGG + Intergenic
929018740 2:37528728-37528750 TGTGTGTATGTTAGGTTGAGGGG + Intergenic
929407921 2:41664461-41664483 TGTTTGTGTGGTCTCCTGGGGGG - Intergenic
930545738 2:52765624-52765646 TGTTTGTTTATTATTTTGAGGGG - Intergenic
931358745 2:61559793-61559815 TGTTTGTTTGTTTTTTTGAGAGG - Intergenic
931654155 2:64495121-64495143 TTTTTGTGTGTGATCTAGGGTGG + Intergenic
932778520 2:74544295-74544317 TGTTTGTTTGTTTTTTTGAGAGG - Intronic
933404009 2:81834854-81834876 TATTTGTATGTCATCTTCTGAGG - Intergenic
934115088 2:88781399-88781421 TGTGTGTATGTCATATTGGTTGG + Intergenic
934868634 2:97838759-97838781 TGTTTGTTTGTTTTTTTGGCAGG + Intronic
935379019 2:102432056-102432078 TCTTTGTAGGTGATCTTTGGTGG + Intronic
935829999 2:106991969-106991991 AATTTATATGTTATCTGGGGTGG + Intergenic
936574347 2:113641110-113641132 GGGTTGTATCTTATCGTGGGAGG - Intronic
938531025 2:132186309-132186331 TGTTTTTATGTTATGTTAGCAGG + Intronic
939018425 2:136929469-136929491 TCTTTGTATGTCATCTTAGTAGG + Intronic
939122245 2:138131450-138131472 TGATTCAATCTTATCTTGGGAGG - Intergenic
940035956 2:149312200-149312222 TGTTTGTCTGGTTTCTTGGGTGG - Intergenic
940635169 2:156290700-156290722 TGTTTTTATGCTATCGTGGATGG + Intergenic
947260011 2:228210384-228210406 TGTGAATATGTTATCTTGTGTGG - Intergenic
948130033 2:235593396-235593418 TATTAGTATGTTTTTTTGGGTGG + Intronic
1169035231 20:2445346-2445368 TGTTTGTTTGTTTTCTGGGAGGG + Intergenic
1169160577 20:3374269-3374291 TGTTTGTATTTTATTTTGCTAGG - Intronic
1171195382 20:23193547-23193569 TGTTTGTTTGTTATTTGTGGTGG + Intergenic
1172423772 20:34840549-34840571 TGTTTGTTTGTTATCATGAAGGG + Intergenic
1173014856 20:39215677-39215699 TATTTGTATGTTATCATAGGGGG + Intergenic
1174840584 20:53897875-53897897 TTTTTGTTTTTTATTTTGGGGGG - Intergenic
1174886810 20:54344849-54344871 TGTTTCTATGTATTCTTGGTGGG - Intergenic
1176765438 21:13013092-13013114 TGTTTTTATGTTATGTTAGCAGG - Intergenic
1177655956 21:24017905-24017927 TGTTTGTATGGTATTTTGTTTGG - Intergenic
1177730472 21:25022185-25022207 TGTTTGTGTGTTATGGGGGGGGG + Intergenic
1178073992 21:28998878-28998900 TGTTTGTTTGTTTTTTTGAGAGG - Intergenic
1178342400 21:31797022-31797044 TGTTAGTGTGTGTTCTTGGGAGG - Intergenic
1180111585 21:45657977-45657999 TGTTTGTTCCTTATCTTAGGGGG + Intronic
1180430014 22:15239573-15239595 TGTTTTTATGTTATGTTAGCAGG - Intergenic
1180589480 22:16924132-16924154 TGTTTATGTGTTTTTTTGGGGGG + Intergenic
1180895435 22:19328549-19328571 TGTTTGTATCCCATCTTGGCAGG - Intergenic
1181625048 22:24117529-24117551 TTTTTGTTTGTTTTTTTGGGGGG + Intronic
1181738563 22:24901658-24901680 TGTTTGTTTGTTTTCTGGGAGGG - Intronic
1182954848 22:34414027-34414049 TATTTGTATGTCTTCTTTGGAGG + Intergenic
1183192435 22:36330408-36330430 TTTTGGTCTGTTATCTTGTGTGG + Intronic
1183198899 22:36372565-36372587 AGTTTGTATTTAATCATGGGAGG + Intronic
1183496229 22:38145773-38145795 TGTGTGTGTGTTTGCTTGGGAGG - Intronic
1185425825 22:50769778-50769800 GGGTTGTATCTTATCGTGGGAGG + Intronic
949505925 3:4727564-4727586 TTTTTGTTTGTTATTTGGGGTGG + Intronic
949641552 3:6041160-6041182 TGTGTGTTTGTGATGTTGGGTGG + Intergenic
950095575 3:10328399-10328421 TGTTTGTTTGTTTTCTTAGGCGG - Exonic
951703221 3:25517349-25517371 TATTTGTATATTTTCTTTGGTGG - Intronic
952519418 3:34141255-34141277 TGTTCGTATATTTTCTTTGGAGG + Intergenic
953301577 3:41781933-41781955 TGTTTGTTTGTTTTTTTAGGTGG - Intronic
953903092 3:46854251-46854273 TGTGTGTGTGTGATCTTGGCGGG - Intergenic
955560535 3:60184322-60184344 TGTTAATATGGTATCTTGGATGG - Intronic
955620400 3:60857157-60857179 TGTGTGGATGCCATCTTGGGAGG + Intronic
956449780 3:69362705-69362727 TTTTTGTTTGTTTTTTTGGGGGG - Intronic
957563328 3:81854323-81854345 TTTTTGTTTGCTATTTTGGGAGG - Intergenic
958965279 3:100551420-100551442 TGCTTGCATGTTCTCTTTGGTGG + Intronic
959664768 3:108908843-108908865 TGTTTGAAAGTCATCTTGTGGGG - Intronic
960968082 3:123119441-123119463 TGTTTGTATATTTTCTTGCTTGG + Intronic
962594181 3:136923140-136923162 TGTGTGTATGTTTTGTTGTGGGG + Intronic
963134637 3:141890262-141890284 TGTTTGTTTGTTTTTTTGTGGGG + Intronic
963289284 3:143471085-143471107 TGTATCTATGTTTTCTTAGGTGG - Intronic
963608803 3:147439351-147439373 TGATTGTTTGCTATCTTGTGTGG + Intronic
964943761 3:162192567-162192589 TGTTTGTCTGTGTTGTTGGGGGG - Intergenic
965348045 3:167576471-167576493 TGTGAATATGTTATCTTAGGTGG + Intronic
965786958 3:172345548-172345570 TCTTTGCATGTTATGTTGAGAGG + Intronic
966525423 3:180913543-180913565 TTTTTGTTTGTTTGCTTGGGAGG + Intronic
966708653 3:182947682-182947704 TGTTTGTTTGTTATTTTTGCAGG - Intronic
967298640 3:187990364-187990386 TGTTTGTTTTGTTTCTTGGGAGG - Intergenic
967615113 3:191555785-191555807 TGTTTGTTTGTTTTCTTGCCTGG + Intergenic
967693239 3:192501677-192501699 TGTTTGTAGGTTATCTTCTCTGG - Intronic
968327453 3:197831542-197831564 TGTTTGTATGTCTTGGTGGGTGG + Intronic
968400589 4:292677-292699 TGTATGTATGTCTTCTTTGGGGG - Intronic
969988093 4:11232384-11232406 TGCGTGTGTGTAATCTTGGGAGG + Intergenic
970546836 4:17138183-17138205 TGTTTGTTTGTTAGTTTTGGTGG - Intergenic
970868911 4:20791695-20791717 AGTTTATATGTTAACTTGGCTGG + Intronic
971600630 4:28586966-28586988 TGTTTGGTTGTTGCCTTGGGTGG + Intergenic
972199255 4:36693613-36693635 TGAATGTATGTTTTCTTGTGTGG - Intergenic
973742972 4:53936114-53936136 TGGTTTTATTTTATTTTGGGGGG + Intronic
974257926 4:59486338-59486360 AGTGTGTTTCTTATCTTGGGAGG + Intergenic
974296770 4:60010089-60010111 TGTGTGTATGTTTTCTAAGGGGG + Intergenic
974320585 4:60343775-60343797 TGGTTGAGTGTTATCTTGTGAGG - Intergenic
974416046 4:61607589-61607611 TGTTTGTTTGTTTGTTTGGGTGG - Intronic
974600058 4:64067619-64067641 TGTTAGTAGGTTATCTTTGAGGG - Intergenic
977629505 4:99226098-99226120 TGTTTGTATGTCTTCTTTGAAGG + Intergenic
977947391 4:102929246-102929268 TGTCTCTCTGTTTTCTTGGGAGG + Intronic
978339023 4:107702034-107702056 CATTTGTATGTTTTCTTTGGAGG - Intronic
979871012 4:125822141-125822163 TGTTTGTATGTTGATTTTGGTGG + Intergenic
980379459 4:131992992-131993014 TCTTTGTACATCATCTTGGGAGG - Intergenic
982195431 4:152907428-152907450 TATTTGTTTCTTAACTTGGGTGG - Intronic
982389163 4:154846063-154846085 TTTTTGTATTTTTTGTTGGGGGG + Intergenic
982545955 4:156733587-156733609 TGTATGAGTGTCATCTTGGGAGG + Intergenic
983253380 4:165370365-165370387 TATTTGCATGTCATCTTGGAAGG + Intronic
983474039 4:168193147-168193169 TGTTTGTTTGTTTTTTTGAGAGG - Intergenic
983687371 4:170427655-170427677 TGCATGTATGTTATCTTTGCAGG + Intergenic
984030840 4:174602171-174602193 TTTTTCTGTGTTATTTTGGGGGG - Intergenic
984271958 4:177558062-177558084 TGTTTGTTTGTTTTTTTGAGAGG - Intergenic
984395115 4:179187832-179187854 TGTTTGTTTGTTTGTTTGGGGGG - Intergenic
984519059 4:180778769-180778791 TGTTTGTTTGTTTTTTTGAGAGG + Intergenic
988158267 5:27483450-27483472 TATTTTTATGTTATCTTTTGTGG + Intergenic
988335211 5:29898835-29898857 TGGTACTATGTTACCTTGGGTGG - Intergenic
990099874 5:52168515-52168537 TGTTTGTATGTTTTATGGGTAGG + Intergenic
991250851 5:64559391-64559413 TGGCTGTATGTTATATTTGGGGG + Intronic
995434747 5:112122961-112122983 AGTTTGTATGTTATTTTCTGTGG - Intergenic
995555166 5:113320470-113320492 TGTTTAAATGTCATCTTGGGAGG + Intronic
995585478 5:113643812-113643834 TGTCAGGATGTTTTCTTGGGGGG + Intergenic
996324294 5:122254948-122254970 TGTTTGTATTTTTTCTGGGGTGG + Intergenic
997001280 5:129765132-129765154 TGTTTTTTTGTTATTTTGGTGGG - Exonic
998326021 5:141280440-141280462 TGTGTGTGTGTTTTTTTGGGGGG - Intergenic
998516279 5:142757467-142757489 TGTGTGTGTGTTATTTTGGATGG + Intergenic
999698377 5:154206048-154206070 TGTCTGTATGTTATATTTGTAGG + Intronic
999956997 5:156713359-156713381 AGTTTTTATATTATCCTGGGGGG + Intronic
1001684470 5:173583128-173583150 TGTTTCTTTGTTTTTTTGGGAGG - Intergenic
1003769233 6:9279079-9279101 TGTTTGTTTGTTTTTCTGGGAGG - Intergenic
1003799645 6:9649290-9649312 TGTTTGTATGTTGGGGTGGGAGG - Intronic
1003901835 6:10661706-10661728 GGTTTTTATGTTATCTTATGGGG - Intergenic
1004144673 6:13054254-13054276 AGTTTGTATGGCATCTTAGGTGG + Intronic
1004726409 6:18315396-18315418 TGTTTGTCTGTTTTGTTGTGAGG + Intergenic
1005857243 6:29871960-29871982 AGTTTGTCTGTTACCTTGGAGGG - Intergenic
1006848654 6:37081284-37081306 TGTGTGTGTGTTTTCTTTGGTGG + Intergenic
1006951395 6:37823785-37823807 TTTTTGTATTTTTTTTTGGGGGG + Intronic
1009355712 6:62740923-62740945 TGCCTGTATGTCATCTGGGGTGG - Intergenic
1009783149 6:68296230-68296252 TGCATGTATGTTTTCTTTGGAGG - Intergenic
1011570711 6:88731172-88731194 TGTTTTTATGTTTTTTTGGGGGG - Intronic
1011712730 6:90070981-90071003 TTTTTGTTTGTTTTTTTGGGGGG + Intronic
1012382213 6:98633732-98633754 TGTTTGTATTTTAACTAGGGAGG - Intergenic
1012681395 6:102186369-102186391 AGTTTTTATTTTATGTTGGGAGG - Intergenic
1014203397 6:118628628-118628650 TGTTTGTTTGTTTTTTTGGATGG - Intronic
1014615939 6:123599816-123599838 TGTTTGCATTTTATCTAGTGTGG + Intronic
1015015293 6:128405591-128405613 TGTTTAAATGTGAGCTTGGGTGG - Intronic
1016261912 6:142182028-142182050 TGTTTATATAATAACTTGGGAGG + Intronic
1016364138 6:143297475-143297497 TGGTTGGATGGTTTCTTGGGTGG + Intronic
1017391966 6:153950038-153950060 TTTTTGTGGGTTTTCTTGGGGGG + Intergenic
1017849407 6:158291216-158291238 TGTTTAGATGTTATATTGCGAGG + Intronic
1020105934 7:5422345-5422367 TCTTTGTAGGTTATTTTGGGGGG - Intronic
1020428222 7:8093514-8093536 TTTTTGTTTGTTTTCTTGAGAGG - Intronic
1022248873 7:28587028-28587050 TGTTCTGATGTTATCTTGGTTGG - Intronic
1022839042 7:34145181-34145203 AGTTTGTGTGTTTACTTGGGTGG + Intronic
1024509692 7:50193962-50193984 TGTTTTAATGTAGTCTTGGGGGG + Intergenic
1024842264 7:53600809-53600831 TGTTTGTTTGTTTGCTTGGTTGG - Intergenic
1024926867 7:54625789-54625811 TGTTTGTATGCATTCTTTGGAGG - Intergenic
1027248419 7:76382981-76383003 TTTTTGTTTGTTTTCTTGAGAGG - Intergenic
1028107763 7:86900871-86900893 TGTTTTTCTGTTTTCTTGGTAGG - Intronic
1030898186 7:115087578-115087600 TGTTGGAATGTTATCTGGAGTGG - Intergenic
1031014766 7:116561282-116561304 TGTTTGTATGTGTTTGTGGGGGG + Intergenic
1031308343 7:120162338-120162360 TGTTTGTTTGTTTGCTTGGTTGG + Intergenic
1031472893 7:122188983-122189005 TGTGTGTGTGTAATCTTGAGGGG - Intergenic
1031723200 7:125203357-125203379 TGTTTTTATTTCAACTTGGGTGG + Intergenic
1031794136 7:126149869-126149891 TGTTTGTTTGTTTGCTTGGTTGG + Intergenic
1031825067 7:126554382-126554404 TCTTGCTATGTTATCTTGGCTGG - Intronic
1032157790 7:129483750-129483772 TGTTTGTTTGTTTTTTTGAGAGG + Intronic
1032824250 7:135553831-135553853 TGTTTGGAGGTTAACTTGGTGGG + Intergenic
1033968892 7:147013029-147013051 TGCTTGTTTGTCATTTTGGGGGG - Intronic
1034985014 7:155506547-155506569 TGTTTGTTTGTTTGTTTGGGGGG - Intronic
1036452304 8:8879646-8879668 TATTTGAATGTTACTTTGGGGGG - Intronic
1037282513 8:17258031-17258053 TGTTTGTCTGTTTTTTTGGTGGG + Intronic
1037902761 8:22697209-22697231 TGTTTGTCTGTTTTATTGGCGGG + Intergenic
1041375707 8:57207928-57207950 TGTTTCTGTGTTACCGTGGGCGG - Intergenic
1041376469 8:57212307-57212329 TGTTTCTGTGTTACCGTGGGCGG - Intergenic
1041377415 8:57217697-57217719 TGTTTCTGTGTTACCGTGGGCGG - Intergenic
1041663133 8:60418196-60418218 TGTTGGGATGTTATCAAGGGAGG - Intergenic
1042031054 8:64475845-64475867 TGTTTGTATGTGTCTTTGGGTGG - Intergenic
1042074193 8:64971134-64971156 TGTTTGTTTGTTCTTTTGTGAGG + Intergenic
1042102612 8:65289759-65289781 TGTTTGAATGTTATGTGGAGAGG - Intergenic
1042908363 8:73798124-73798146 TTTTTGTATATTTTGTTGGGGGG - Intronic
1043428174 8:80169541-80169563 TGTTTGTGTTCTAGCTTGGGTGG - Intronic
1043692122 8:83167825-83167847 TGTTTCTGTGTTATCTGGGAAGG - Intergenic
1043771935 8:84214160-84214182 TGTTAGGTTGTTACCTTGGGTGG + Intronic
1043973439 8:86558554-86558576 TCTTTCTAGGTTATTTTGGGGGG + Exonic
1045650148 8:104334245-104334267 TGTTTGTTTGTTATGTTTTGGGG - Intronic
1045789208 8:105961988-105962010 TGTTTGTCTGTTAGCATTGGTGG - Intergenic
1046410000 8:113829288-113829310 TGTTTGTTTGTTTTTTTGGTTGG + Intergenic
1048622256 8:136147029-136147051 TGTGAGTATGTTATCTTGTCTGG + Intergenic
1049142561 8:140969194-140969216 TTTTTGGATGTTATGTTAGGAGG - Intronic
1050631863 9:7568172-7568194 TGTGTGTATGTTTGGTTGGGGGG + Intergenic
1051211795 9:14752845-14752867 TGTTTGTTTGTTTGTTTGGGGGG - Intronic
1051944555 9:22551590-22551612 TGTGTATATGTTATGTTGCGTGG + Intergenic
1052288915 9:26820392-26820414 TGTTTGTGTATTATCTTGATAGG - Intergenic
1052623169 9:30940944-30940966 TGTTTGTATTTTATGCTGAGAGG - Intergenic
1052765640 9:32637458-32637480 TGATTGCAGATTATCTTGGGTGG + Intergenic
1053709629 9:40792850-40792872 TGTTTTTATGTTATGTTAGCAGG + Intergenic
1054419533 9:64913638-64913660 TGTTTTTATGTTATGTTAGCAGG + Intergenic
1055479559 9:76696453-76696475 TGTTTGTTTGTTATCCAGGCTGG + Intronic
1056645327 9:88406921-88406943 TGTCTGTATTTTATCTTGACAGG + Intronic
1056793316 9:89639999-89640021 AGTCTGGGTGTTATCTTGGGAGG + Intergenic
1058436149 9:104965542-104965564 TGTTTGTTTGTTTTCTGAGGCGG + Intergenic
1060670993 9:125469352-125469374 TGTGTGTGTTTTATTTTGGGGGG - Intronic
1186628561 X:11322614-11322636 TGAATGTATGCTATCTTGGAAGG - Intronic
1188540405 X:31243447-31243469 TTTTTGTGTGTTATGTTGAGGGG - Intronic
1188803242 X:34557360-34557382 TGTTTGTATGCTAGTTTGGTAGG - Intergenic
1189161523 X:38813991-38814013 TGTGAGTATGTTACCTTGCGTGG + Intergenic
1191183823 X:57589442-57589464 TGTTTGTATATTGTGTTGAGTGG - Intergenic
1192190199 X:68986446-68986468 TGTGTGTCTGCTACCTTGGGTGG - Intergenic
1192746627 X:73944979-73945001 TGTGTGTGTGTAATCTTTGGGGG + Intergenic
1193866239 X:86733995-86734017 TGTTTGTTTGTTAGTTTGGGTGG + Intronic
1195381263 X:104273224-104273246 TGTTTGTTTGTTTGCTTGGTTGG + Intergenic
1195538176 X:106032873-106032895 TGGAAGTATGTTTTCTTGGGGGG + Exonic
1196286223 X:113883460-113883482 TTTCTGTATGTCATTTTGGGTGG + Intergenic
1196299311 X:114036729-114036751 TGTTTCTACCTGATCTTGGGTGG - Intergenic
1198938224 X:141922414-141922436 TGATTGTATGATTTCTTGAGTGG + Intergenic
1199172518 X:144747491-144747513 TGTTTGTTTGTTTTTTTGGCTGG + Intergenic
1200396805 X:155995237-155995259 TGTTTGTTTGTTATTTTAGCAGG + Intergenic
1201710072 Y:16981352-16981374 TATTTGTATGTTATATTAGATGG - Intergenic
1201893368 Y:18967509-18967531 TGTTTGTTTGTTTTGGTGGGTGG - Intergenic