ID: 1141847760

View in Genome Browser
Species Human (GRCh38)
Location 16:86622438-86622460
Sequence CATCATGACCACCTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141847756_1141847760 -8 Left 1141847756 16:86622423-86622445 CCCAGTAAATCCTTTCATCATGA No data
Right 1141847760 16:86622438-86622460 CATCATGACCACCTGGAGCCTGG No data
1141847754_1141847760 -3 Left 1141847754 16:86622418-86622440 CCCTTCCCAGTAAATCCTTTCAT No data
Right 1141847760 16:86622438-86622460 CATCATGACCACCTGGAGCCTGG No data
1141847752_1141847760 -1 Left 1141847752 16:86622416-86622438 CCCCCTTCCCAGTAAATCCTTTC No data
Right 1141847760 16:86622438-86622460 CATCATGACCACCTGGAGCCTGG No data
1141847753_1141847760 -2 Left 1141847753 16:86622417-86622439 CCCCTTCCCAGTAAATCCTTTCA No data
Right 1141847760 16:86622438-86622460 CATCATGACCACCTGGAGCCTGG No data
1141847750_1141847760 14 Left 1141847750 16:86622401-86622423 CCAAATTGTCCAAATCCCCCTTC No data
Right 1141847760 16:86622438-86622460 CATCATGACCACCTGGAGCCTGG No data
1141847755_1141847760 -4 Left 1141847755 16:86622419-86622441 CCTTCCCAGTAAATCCTTTCATC No data
Right 1141847760 16:86622438-86622460 CATCATGACCACCTGGAGCCTGG No data
1141847751_1141847760 5 Left 1141847751 16:86622410-86622432 CCAAATCCCCCTTCCCAGTAAAT No data
Right 1141847760 16:86622438-86622460 CATCATGACCACCTGGAGCCTGG No data
1141847757_1141847760 -9 Left 1141847757 16:86622424-86622446 CCAGTAAATCCTTTCATCATGAC No data
Right 1141847760 16:86622438-86622460 CATCATGACCACCTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141847760 Original CRISPR CATCATGACCACCTGGAGCC TGG Intergenic
No off target data available for this crispr