ID: 1141851073

View in Genome Browser
Species Human (GRCh38)
Location 16:86646475-86646497
Sequence GACTCGGATGTGACTGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141851069_1141851073 30 Left 1141851069 16:86646422-86646444 CCAAGAATGAAGGAATATTGTAA No data
Right 1141851073 16:86646475-86646497 GACTCGGATGTGACTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141851073 Original CRISPR GACTCGGATGTGACTGCCCC TGG Intergenic
No off target data available for this crispr