ID: 1141852029

View in Genome Browser
Species Human (GRCh38)
Location 16:86652990-86653012
Sequence CAGAGGGTCTGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141852029_1141852038 25 Left 1141852029 16:86652990-86653012 CCTTCTTCCCTCCAGACCCTCTG No data
Right 1141852038 16:86653038-86653060 ATTTGCATTTGATACTATTCAGG No data
1141852029_1141852035 0 Left 1141852029 16:86652990-86653012 CCTTCTTCCCTCCAGACCCTCTG No data
Right 1141852035 16:86653013-86653035 ACCACCTCATTTGAAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141852029 Original CRISPR CAGAGGGTCTGGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr