ID: 1141852168

View in Genome Browser
Species Human (GRCh38)
Location 16:86653883-86653905
Sequence GGGACCAGGAGGAAACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141852168_1141852174 -8 Left 1141852168 16:86653883-86653905 CCTGCTGGTTTCCTCCTGGTCCC No data
Right 1141852174 16:86653898-86653920 CTGGTCCCACGACAGGGTGGAGG No data
1141852168_1141852178 12 Left 1141852168 16:86653883-86653905 CCTGCTGGTTTCCTCCTGGTCCC No data
Right 1141852178 16:86653918-86653940 AGGTGCTCAGATTGGTTCTTTGG No data
1141852168_1141852179 16 Left 1141852168 16:86653883-86653905 CCTGCTGGTTTCCTCCTGGTCCC No data
Right 1141852179 16:86653922-86653944 GCTCAGATTGGTTCTTTGGCAGG No data
1141852168_1141852180 17 Left 1141852168 16:86653883-86653905 CCTGCTGGTTTCCTCCTGGTCCC No data
Right 1141852180 16:86653923-86653945 CTCAGATTGGTTCTTTGGCAGGG No data
1141852168_1141852177 4 Left 1141852168 16:86653883-86653905 CCTGCTGGTTTCCTCCTGGTCCC No data
Right 1141852177 16:86653910-86653932 CAGGGTGGAGGTGCTCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141852168 Original CRISPR GGGACCAGGAGGAAACCAGC AGG (reversed) Intergenic
No off target data available for this crispr