ID: 1141852174

View in Genome Browser
Species Human (GRCh38)
Location 16:86653898-86653920
Sequence CTGGTCCCACGACAGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141852164_1141852174 7 Left 1141852164 16:86653868-86653890 CCTGGGAAGCTTGGCCCTGCTGG No data
Right 1141852174 16:86653898-86653920 CTGGTCCCACGACAGGGTGGAGG No data
1141852168_1141852174 -8 Left 1141852168 16:86653883-86653905 CCTGCTGGTTTCCTCCTGGTCCC No data
Right 1141852174 16:86653898-86653920 CTGGTCCCACGACAGGGTGGAGG No data
1141852161_1141852174 23 Left 1141852161 16:86653852-86653874 CCCGGCTGCAGCAGCTCCTGGGA No data
Right 1141852174 16:86653898-86653920 CTGGTCCCACGACAGGGTGGAGG No data
1141852167_1141852174 -7 Left 1141852167 16:86653882-86653904 CCCTGCTGGTTTCCTCCTGGTCC No data
Right 1141852174 16:86653898-86653920 CTGGTCCCACGACAGGGTGGAGG No data
1141852158_1141852174 30 Left 1141852158 16:86653845-86653867 CCATCTTCCCGGCTGCAGCAGCT No data
Right 1141852174 16:86653898-86653920 CTGGTCCCACGACAGGGTGGAGG No data
1141852162_1141852174 22 Left 1141852162 16:86653853-86653875 CCGGCTGCAGCAGCTCCTGGGAA No data
Right 1141852174 16:86653898-86653920 CTGGTCCCACGACAGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141852174 Original CRISPR CTGGTCCCACGACAGGGTGG AGG Intergenic
No off target data available for this crispr