ID: 1141852177

View in Genome Browser
Species Human (GRCh38)
Location 16:86653910-86653932
Sequence CAGGGTGGAGGTGCTCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141852171_1141852177 -7 Left 1141852171 16:86653894-86653916 CCTCCTGGTCCCACGACAGGGTG No data
Right 1141852177 16:86653910-86653932 CAGGGTGGAGGTGCTCAGATTGG No data
1141852167_1141852177 5 Left 1141852167 16:86653882-86653904 CCCTGCTGGTTTCCTCCTGGTCC No data
Right 1141852177 16:86653910-86653932 CAGGGTGGAGGTGCTCAGATTGG No data
1141852173_1141852177 -10 Left 1141852173 16:86653897-86653919 CCTGGTCCCACGACAGGGTGGAG No data
Right 1141852177 16:86653910-86653932 CAGGGTGGAGGTGCTCAGATTGG No data
1141852164_1141852177 19 Left 1141852164 16:86653868-86653890 CCTGGGAAGCTTGGCCCTGCTGG No data
Right 1141852177 16:86653910-86653932 CAGGGTGGAGGTGCTCAGATTGG No data
1141852168_1141852177 4 Left 1141852168 16:86653883-86653905 CCTGCTGGTTTCCTCCTGGTCCC No data
Right 1141852177 16:86653910-86653932 CAGGGTGGAGGTGCTCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141852177 Original CRISPR CAGGGTGGAGGTGCTCAGAT TGG Intergenic
No off target data available for this crispr