ID: 1141852178

View in Genome Browser
Species Human (GRCh38)
Location 16:86653918-86653940
Sequence AGGTGCTCAGATTGGTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141852175_1141852178 -8 Left 1141852175 16:86653903-86653925 CCCACGACAGGGTGGAGGTGCTC No data
Right 1141852178 16:86653918-86653940 AGGTGCTCAGATTGGTTCTTTGG No data
1141852164_1141852178 27 Left 1141852164 16:86653868-86653890 CCTGGGAAGCTTGGCCCTGCTGG No data
Right 1141852178 16:86653918-86653940 AGGTGCTCAGATTGGTTCTTTGG No data
1141852173_1141852178 -2 Left 1141852173 16:86653897-86653919 CCTGGTCCCACGACAGGGTGGAG No data
Right 1141852178 16:86653918-86653940 AGGTGCTCAGATTGGTTCTTTGG No data
1141852168_1141852178 12 Left 1141852168 16:86653883-86653905 CCTGCTGGTTTCCTCCTGGTCCC No data
Right 1141852178 16:86653918-86653940 AGGTGCTCAGATTGGTTCTTTGG No data
1141852176_1141852178 -9 Left 1141852176 16:86653904-86653926 CCACGACAGGGTGGAGGTGCTCA No data
Right 1141852178 16:86653918-86653940 AGGTGCTCAGATTGGTTCTTTGG No data
1141852171_1141852178 1 Left 1141852171 16:86653894-86653916 CCTCCTGGTCCCACGACAGGGTG No data
Right 1141852178 16:86653918-86653940 AGGTGCTCAGATTGGTTCTTTGG No data
1141852167_1141852178 13 Left 1141852167 16:86653882-86653904 CCCTGCTGGTTTCCTCCTGGTCC No data
Right 1141852178 16:86653918-86653940 AGGTGCTCAGATTGGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141852178 Original CRISPR AGGTGCTCAGATTGGTTCTT TGG Intergenic
No off target data available for this crispr