ID: 1141855710

View in Genome Browser
Species Human (GRCh38)
Location 16:86680124-86680146
Sequence CTGTGGCAGGCACTATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141855710_1141855716 29 Left 1141855710 16:86680124-86680146 CCCCAAAATAGTGCCTGCCACAG No data
Right 1141855716 16:86680176-86680198 GACTGAGAGAACTGACTCTCAGG No data
1141855710_1141855717 30 Left 1141855710 16:86680124-86680146 CCCCAAAATAGTGCCTGCCACAG No data
Right 1141855717 16:86680177-86680199 ACTGAGAGAACTGACTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141855710 Original CRISPR CTGTGGCAGGCACTATTTTG GGG (reversed) Intergenic
No off target data available for this crispr