ID: 1141855716

View in Genome Browser
Species Human (GRCh38)
Location 16:86680176-86680198
Sequence GACTGAGAGAACTGACTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141855710_1141855716 29 Left 1141855710 16:86680124-86680146 CCCCAAAATAGTGCCTGCCACAG No data
Right 1141855716 16:86680176-86680198 GACTGAGAGAACTGACTCTCAGG No data
1141855714_1141855716 16 Left 1141855714 16:86680137-86680159 CCTGCCACAGAGTAGGAGCTCAA No data
Right 1141855716 16:86680176-86680198 GACTGAGAGAACTGACTCTCAGG No data
1141855711_1141855716 28 Left 1141855711 16:86680125-86680147 CCCAAAATAGTGCCTGCCACAGA No data
Right 1141855716 16:86680176-86680198 GACTGAGAGAACTGACTCTCAGG No data
1141855715_1141855716 12 Left 1141855715 16:86680141-86680163 CCACAGAGTAGGAGCTCAATTTA No data
Right 1141855716 16:86680176-86680198 GACTGAGAGAACTGACTCTCAGG No data
1141855712_1141855716 27 Left 1141855712 16:86680126-86680148 CCAAAATAGTGCCTGCCACAGAG No data
Right 1141855716 16:86680176-86680198 GACTGAGAGAACTGACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141855716 Original CRISPR GACTGAGAGAACTGACTCTC AGG Intergenic
No off target data available for this crispr