ID: 1141859937

View in Genome Browser
Species Human (GRCh38)
Location 16:86709670-86709692
Sequence CAGTGAAGCTGGAGAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141859930_1141859937 23 Left 1141859930 16:86709624-86709646 CCTTCAGGGTGGACGCAAGGGAG No data
Right 1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG No data
1141859935_1141859937 -2 Left 1141859935 16:86709649-86709671 CCTTCGGGGAGAAGCAGTGAGCA No data
Right 1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG No data
1141859934_1141859937 -1 Left 1141859934 16:86709648-86709670 CCCTTCGGGGAGAAGCAGTGAGC No data
Right 1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141859937 Original CRISPR CAGTGAAGCTGGAGAGAAGC AGG Intergenic
No off target data available for this crispr