ID: 1141860386

View in Genome Browser
Species Human (GRCh38)
Location 16:86712344-86712366
Sequence CAGGTAATGCACCCAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141860386_1141860401 21 Left 1141860386 16:86712344-86712366 CCCGCAGCTGGGTGCATTACCTG No data
Right 1141860401 16:86712388-86712410 GGGCAGGAGTTTCCTTGGCGGGG No data
1141860386_1141860399 19 Left 1141860386 16:86712344-86712366 CCCGCAGCTGGGTGCATTACCTG No data
Right 1141860399 16:86712386-86712408 CTGGGCAGGAGTTTCCTTGGCGG No data
1141860386_1141860392 0 Left 1141860386 16:86712344-86712366 CCCGCAGCTGGGTGCATTACCTG No data
Right 1141860392 16:86712367-86712389 GGGCTACGTCCGTGTTGCCCTGG No data
1141860386_1141860403 26 Left 1141860386 16:86712344-86712366 CCCGCAGCTGGGTGCATTACCTG No data
Right 1141860403 16:86712393-86712415 GGAGTTTCCTTGGCGGGGGCAGG No data
1141860386_1141860393 1 Left 1141860386 16:86712344-86712366 CCCGCAGCTGGGTGCATTACCTG No data
Right 1141860393 16:86712368-86712390 GGCTACGTCCGTGTTGCCCTGGG No data
1141860386_1141860400 20 Left 1141860386 16:86712344-86712366 CCCGCAGCTGGGTGCATTACCTG No data
Right 1141860400 16:86712387-86712409 TGGGCAGGAGTTTCCTTGGCGGG No data
1141860386_1141860394 5 Left 1141860386 16:86712344-86712366 CCCGCAGCTGGGTGCATTACCTG No data
Right 1141860394 16:86712372-86712394 ACGTCCGTGTTGCCCTGGGCAGG No data
1141860386_1141860402 22 Left 1141860386 16:86712344-86712366 CCCGCAGCTGGGTGCATTACCTG No data
Right 1141860402 16:86712389-86712411 GGCAGGAGTTTCCTTGGCGGGGG No data
1141860386_1141860396 16 Left 1141860386 16:86712344-86712366 CCCGCAGCTGGGTGCATTACCTG No data
Right 1141860396 16:86712383-86712405 GCCCTGGGCAGGAGTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141860386 Original CRISPR CAGGTAATGCACCCAGCTGC GGG (reversed) Intergenic
No off target data available for this crispr