ID: 1141863491

View in Genome Browser
Species Human (GRCh38)
Location 16:86733940-86733962
Sequence CCGCCCTGACACCTTGACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141863491_1141863507 27 Left 1141863491 16:86733940-86733962 CCAACGTCAAGGTGTCAGGGCGG No data
Right 1141863507 16:86733990-86734012 TCCGGCCTCTTCCTGCTCCTGGG No data
1141863491_1141863496 -8 Left 1141863491 16:86733940-86733962 CCAACGTCAAGGTGTCAGGGCGG No data
Right 1141863496 16:86733955-86733977 CAGGGCGGGGCTCCCCCAGGAGG No data
1141863491_1141863510 29 Left 1141863491 16:86733940-86733962 CCAACGTCAAGGTGTCAGGGCGG No data
Right 1141863510 16:86733992-86734014 CGGCCTCTTCCTGCTCCTGGGGG No data
1141863491_1141863502 9 Left 1141863491 16:86733940-86733962 CCAACGTCAAGGTGTCAGGGCGG No data
Right 1141863502 16:86733972-86733994 AGGAGGATCCAGGACCCTTCCGG No data
1141863491_1141863497 -1 Left 1141863491 16:86733940-86733962 CCAACGTCAAGGTGTCAGGGCGG No data
Right 1141863497 16:86733962-86733984 GGGCTCCCCCAGGAGGATCCAGG No data
1141863491_1141863506 26 Left 1141863491 16:86733940-86733962 CCAACGTCAAGGTGTCAGGGCGG No data
Right 1141863506 16:86733989-86734011 TTCCGGCCTCTTCCTGCTCCTGG No data
1141863491_1141863509 28 Left 1141863491 16:86733940-86733962 CCAACGTCAAGGTGTCAGGGCGG No data
Right 1141863509 16:86733991-86734013 CCGGCCTCTTCCTGCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141863491 Original CRISPR CCGCCCTGACACCTTGACGT TGG (reversed) Intergenic
No off target data available for this crispr