ID: 1141867678

View in Genome Browser
Species Human (GRCh38)
Location 16:86761861-86761883
Sequence CCCGAGGGATGGATTCCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141867675_1141867678 -9 Left 1141867675 16:86761847-86761869 CCGGCGGCTTCTGTCCCGAGGGA No data
Right 1141867678 16:86761861-86761883 CCCGAGGGATGGATTCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141867678 Original CRISPR CCCGAGGGATGGATTCCATT AGG Intergenic