ID: 1141867696

View in Genome Browser
Species Human (GRCh38)
Location 16:86762059-86762081
Sequence ATGGAAAATCAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141867692_1141867696 14 Left 1141867692 16:86762022-86762044 CCTTGCTTTGAGCCAACACAGTA No data
Right 1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG No data
1141867691_1141867696 23 Left 1141867691 16:86762013-86762035 CCTGAGTGTCCTTGCTTTGAGCC No data
Right 1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG No data
1141867693_1141867696 2 Left 1141867693 16:86762034-86762056 CCAACACAGTATCTGCTGCACTA No data
Right 1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141867696 Original CRISPR ATGGAAAATCAGAATGAGGA AGG Intergenic
No off target data available for this crispr