ID: 1141868170

View in Genome Browser
Species Human (GRCh38)
Location 16:86765427-86765449
Sequence TGTACTTTTCGAAGCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141868170_1141868176 5 Left 1141868170 16:86765427-86765449 CCACCTCAGCTTCGAAAAGTACA No data
Right 1141868176 16:86765455-86765477 ATTGAGTTTTTGAAAGGGCCAGG No data
1141868170_1141868175 0 Left 1141868170 16:86765427-86765449 CCACCTCAGCTTCGAAAAGTACA No data
Right 1141868175 16:86765450-86765472 GGGTCATTGAGTTTTTGAAAGGG No data
1141868170_1141868177 17 Left 1141868170 16:86765427-86765449 CCACCTCAGCTTCGAAAAGTACA No data
Right 1141868177 16:86765467-86765489 AAAGGGCCAGGAATTAACCAAGG No data
1141868170_1141868174 -1 Left 1141868170 16:86765427-86765449 CCACCTCAGCTTCGAAAAGTACA No data
Right 1141868174 16:86765449-86765471 AGGGTCATTGAGTTTTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141868170 Original CRISPR TGTACTTTTCGAAGCTGAGG TGG (reversed) Intergenic
No off target data available for this crispr