ID: 1141870510

View in Genome Browser
Species Human (GRCh38)
Location 16:86782298-86782320
Sequence CCATTCCTAAGCATATCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141870510_1141870512 -7 Left 1141870510 16:86782298-86782320 CCAGGGGATATGCTTAGGAATGG No data
Right 1141870512 16:86782314-86782336 GGAATGGAATTACAAATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141870510 Original CRISPR CCATTCCTAAGCATATCCCC TGG (reversed) Intergenic
No off target data available for this crispr