ID: 1141874896

View in Genome Browser
Species Human (GRCh38)
Location 16:86817348-86817370
Sequence CTTGCTGCACAGGGGCTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141874896_1141874903 6 Left 1141874896 16:86817348-86817370 CCCATAAGCCCCTGTGCAGCAAG No data
Right 1141874903 16:86817377-86817399 CCCGTCTTCCCTTTTGAACCTGG No data
1141874896_1141874909 16 Left 1141874896 16:86817348-86817370 CCCATAAGCCCCTGTGCAGCAAG No data
Right 1141874909 16:86817387-86817409 CTTTTGAACCTGGCATGGGCAGG No data
1141874896_1141874905 11 Left 1141874896 16:86817348-86817370 CCCATAAGCCCCTGTGCAGCAAG No data
Right 1141874905 16:86817382-86817404 CTTCCCTTTTGAACCTGGCATGG No data
1141874896_1141874906 12 Left 1141874896 16:86817348-86817370 CCCATAAGCCCCTGTGCAGCAAG No data
Right 1141874906 16:86817383-86817405 TTCCCTTTTGAACCTGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141874896 Original CRISPR CTTGCTGCACAGGGGCTTAT GGG (reversed) Intergenic
No off target data available for this crispr