ID: 1141879358

View in Genome Browser
Species Human (GRCh38)
Location 16:86847581-86847603
Sequence CGTCCAGCCAGGAGACCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141879358_1141879361 -5 Left 1141879358 16:86847581-86847603 CCTGGAGGTCTCCTGGCTGGACG No data
Right 1141879361 16:86847599-86847621 GGACGCTGTGGAGCTGAGAATGG No data
1141879358_1141879365 8 Left 1141879358 16:86847581-86847603 CCTGGAGGTCTCCTGGCTGGACG No data
Right 1141879365 16:86847612-86847634 CTGAGAATGGGGCTCCTTCTGGG No data
1141879358_1141879366 9 Left 1141879358 16:86847581-86847603 CCTGGAGGTCTCCTGGCTGGACG No data
Right 1141879366 16:86847613-86847635 TGAGAATGGGGCTCCTTCTGGGG No data
1141879358_1141879363 -3 Left 1141879358 16:86847581-86847603 CCTGGAGGTCTCCTGGCTGGACG No data
Right 1141879363 16:86847601-86847623 ACGCTGTGGAGCTGAGAATGGGG No data
1141879358_1141879364 7 Left 1141879358 16:86847581-86847603 CCTGGAGGTCTCCTGGCTGGACG No data
Right 1141879364 16:86847611-86847633 GCTGAGAATGGGGCTCCTTCTGG No data
1141879358_1141879362 -4 Left 1141879358 16:86847581-86847603 CCTGGAGGTCTCCTGGCTGGACG No data
Right 1141879362 16:86847600-86847622 GACGCTGTGGAGCTGAGAATGGG No data
1141879358_1141879367 10 Left 1141879358 16:86847581-86847603 CCTGGAGGTCTCCTGGCTGGACG No data
Right 1141879367 16:86847614-86847636 GAGAATGGGGCTCCTTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141879358 Original CRISPR CGTCCAGCCAGGAGACCTCC AGG (reversed) Intergenic
No off target data available for this crispr