ID: 1141880356

View in Genome Browser
Species Human (GRCh38)
Location 16:86854441-86854463
Sequence CTCTGTTGAAAGCCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141880356_1141880364 16 Left 1141880356 16:86854441-86854463 CCCTGGCCTGGCTTTCAACAGAG No data
Right 1141880364 16:86854480-86854502 CTCTATTCTTTATGACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141880356 Original CRISPR CTCTGTTGAAAGCCAGGCCA GGG (reversed) Intergenic
No off target data available for this crispr