ID: 1141882017

View in Genome Browser
Species Human (GRCh38)
Location 16:86866526-86866548
Sequence AAGTCTCAGCTCCTGCACAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141882017_1141882020 29 Left 1141882017 16:86866526-86866548 CCGGTGTGCAGGAGCTGAGACTT No data
Right 1141882020 16:86866578-86866600 TCACCAGCCCCAGACCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141882017 Original CRISPR AAGTCTCAGCTCCTGCACAC CGG (reversed) Intergenic
No off target data available for this crispr