ID: 1141883527

View in Genome Browser
Species Human (GRCh38)
Location 16:86875608-86875630
Sequence ATGACCACGATCCCTCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141883527_1141883529 9 Left 1141883527 16:86875608-86875630 CCAAACAGAGGGATCGTGGTCAT No data
Right 1141883529 16:86875640-86875662 TTTCTTCATCCCTAGAGGCCAGG No data
1141883527_1141883530 17 Left 1141883527 16:86875608-86875630 CCAAACAGAGGGATCGTGGTCAT No data
Right 1141883530 16:86875648-86875670 TCCCTAGAGGCCAGGTCTATAGG No data
1141883527_1141883528 4 Left 1141883527 16:86875608-86875630 CCAAACAGAGGGATCGTGGTCAT No data
Right 1141883528 16:86875635-86875657 GATGTTTTCTTCATCCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141883527 Original CRISPR ATGACCACGATCCCTCTGTT TGG (reversed) Intergenic
No off target data available for this crispr