ID: 1141883530

View in Genome Browser
Species Human (GRCh38)
Location 16:86875648-86875670
Sequence TCCCTAGAGGCCAGGTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141883527_1141883530 17 Left 1141883527 16:86875608-86875630 CCAAACAGAGGGATCGTGGTCAT No data
Right 1141883530 16:86875648-86875670 TCCCTAGAGGCCAGGTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141883530 Original CRISPR TCCCTAGAGGCCAGGTCTAT AGG Intergenic
No off target data available for this crispr