ID: 1141883887

View in Genome Browser
Species Human (GRCh38)
Location 16:86878789-86878811
Sequence CTGTGTGCCTGTCGGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141883887_1141883896 29 Left 1141883887 16:86878789-86878811 CCATCTGTCCGACAGGCACACAG No data
Right 1141883896 16:86878841-86878863 ACCCCGAGCTCCCGCAAGGTCGG No data
1141883887_1141883895 25 Left 1141883887 16:86878789-86878811 CCATCTGTCCGACAGGCACACAG No data
Right 1141883895 16:86878837-86878859 CTTCACCCCGAGCTCCCGCAAGG No data
1141883887_1141883890 -6 Left 1141883887 16:86878789-86878811 CCATCTGTCCGACAGGCACACAG No data
Right 1141883890 16:86878806-86878828 ACACAGAGCGCCGCCAGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141883887 Original CRISPR CTGTGTGCCTGTCGGACAGA TGG (reversed) Intergenic
No off target data available for this crispr