ID: 1141883890

View in Genome Browser
Species Human (GRCh38)
Location 16:86878806-86878828
Sequence ACACAGAGCGCCGCCAGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141883883_1141883890 23 Left 1141883883 16:86878760-86878782 CCTGAAAGTCACTCGTTCTGAGC No data
Right 1141883890 16:86878806-86878828 ACACAGAGCGCCGCCAGGCACGG No data
1141883884_1141883890 1 Left 1141883884 16:86878782-86878804 CCAGCCTCCATCTGTCCGACAGG No data
Right 1141883890 16:86878806-86878828 ACACAGAGCGCCGCCAGGCACGG No data
1141883887_1141883890 -6 Left 1141883887 16:86878789-86878811 CCATCTGTCCGACAGGCACACAG No data
Right 1141883890 16:86878806-86878828 ACACAGAGCGCCGCCAGGCACGG No data
1141883886_1141883890 -3 Left 1141883886 16:86878786-86878808 CCTCCATCTGTCCGACAGGCACA No data
Right 1141883890 16:86878806-86878828 ACACAGAGCGCCGCCAGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141883890 Original CRISPR ACACAGAGCGCCGCCAGGCA CGG Intergenic
No off target data available for this crispr