ID: 1141883895

View in Genome Browser
Species Human (GRCh38)
Location 16:86878837-86878859
Sequence CTTCACCCCGAGCTCCCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141883891_1141883895 -2 Left 1141883891 16:86878816-86878838 CCGCCAGGCACGGCCCTCATTCT No data
Right 1141883895 16:86878837-86878859 CTTCACCCCGAGCTCCCGCAAGG No data
1141883887_1141883895 25 Left 1141883887 16:86878789-86878811 CCATCTGTCCGACAGGCACACAG No data
Right 1141883895 16:86878837-86878859 CTTCACCCCGAGCTCCCGCAAGG No data
1141883888_1141883895 17 Left 1141883888 16:86878797-86878819 CCGACAGGCACACAGAGCGCCGC No data
Right 1141883895 16:86878837-86878859 CTTCACCCCGAGCTCCCGCAAGG No data
1141883892_1141883895 -5 Left 1141883892 16:86878819-86878841 CCAGGCACGGCCCTCATTCTTCA No data
Right 1141883895 16:86878837-86878859 CTTCACCCCGAGCTCCCGCAAGG No data
1141883886_1141883895 28 Left 1141883886 16:86878786-86878808 CCTCCATCTGTCCGACAGGCACA No data
Right 1141883895 16:86878837-86878859 CTTCACCCCGAGCTCCCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141883895 Original CRISPR CTTCACCCCGAGCTCCCGCA AGG Intergenic
No off target data available for this crispr