ID: 1141885710

View in Genome Browser
Species Human (GRCh38)
Location 16:86890847-86890869
Sequence GTGCCCTCACTGTGCATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141885710_1141885716 14 Left 1141885710 16:86890847-86890869 CCTCCCATGCACAGTGAGGGCAC No data
Right 1141885716 16:86890884-86890906 CCTTTGTTCCAAGAAGCAGACGG No data
1141885710_1141885719 29 Left 1141885710 16:86890847-86890869 CCTCCCATGCACAGTGAGGGCAC No data
Right 1141885719 16:86890899-86890921 GCAGACGGAGGCACAGAGAGAGG No data
1141885710_1141885717 17 Left 1141885710 16:86890847-86890869 CCTCCCATGCACAGTGAGGGCAC No data
Right 1141885717 16:86890887-86890909 TTGTTCCAAGAAGCAGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141885710 Original CRISPR GTGCCCTCACTGTGCATGGG AGG (reversed) Intergenic
No off target data available for this crispr