ID: 1141885722

View in Genome Browser
Species Human (GRCh38)
Location 16:86890926-86890948
Sequence TGCTAGAGGCTGACCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141885718_1141885722 11 Left 1141885718 16:86890892-86890914 CCAAGAAGCAGACGGAGGCACAG No data
Right 1141885722 16:86890926-86890948 TGCTAGAGGCTGACCCAGGCAGG No data
1141885715_1141885722 19 Left 1141885715 16:86890884-86890906 CCTTTGTTCCAAGAAGCAGACGG No data
Right 1141885722 16:86890926-86890948 TGCTAGAGGCTGACCCAGGCAGG No data
1141885714_1141885722 20 Left 1141885714 16:86890883-86890905 CCCTTTGTTCCAAGAAGCAGACG No data
Right 1141885722 16:86890926-86890948 TGCTAGAGGCTGACCCAGGCAGG No data
1141885713_1141885722 27 Left 1141885713 16:86890876-86890898 CCTTACTCCCTTTGTTCCAAGAA No data
Right 1141885722 16:86890926-86890948 TGCTAGAGGCTGACCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141885722 Original CRISPR TGCTAGAGGCTGACCCAGGC AGG Intergenic
No off target data available for this crispr