ID: 1141886389

View in Genome Browser
Species Human (GRCh38)
Location 16:86895256-86895278
Sequence ATGCCACCAGCTTCTTGTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141886389_1141886394 -6 Left 1141886389 16:86895256-86895278 CCGCTACAAGAAGCTGGTGGCAT No data
Right 1141886394 16:86895273-86895295 TGGCATGGGGGATCTTCTACAGG No data
1141886389_1141886397 16 Left 1141886389 16:86895256-86895278 CCGCTACAAGAAGCTGGTGGCAT No data
Right 1141886397 16:86895295-86895317 GTTGTTGTTGGCATCGATTAGGG No data
1141886389_1141886396 15 Left 1141886389 16:86895256-86895278 CCGCTACAAGAAGCTGGTGGCAT No data
Right 1141886396 16:86895294-86895316 GGTTGTTGTTGGCATCGATTAGG No data
1141886389_1141886395 4 Left 1141886389 16:86895256-86895278 CCGCTACAAGAAGCTGGTGGCAT No data
Right 1141886395 16:86895283-86895305 GATCTTCTACAGGTTGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141886389 Original CRISPR ATGCCACCAGCTTCTTGTAG CGG (reversed) Intergenic