ID: 1141887553

View in Genome Browser
Species Human (GRCh38)
Location 16:86902980-86903002
Sequence ATTGTATTTTGAAGGACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141887553_1141887559 28 Left 1141887553 16:86902980-86903002 CCTCTGGTCCTTCAAAATACAAT No data
Right 1141887559 16:86903031-86903053 CTTGCATGTGCTCTGCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141887553 Original CRISPR ATTGTATTTTGAAGGACCAG AGG (reversed) Intergenic
No off target data available for this crispr