ID: 1141887795

View in Genome Browser
Species Human (GRCh38)
Location 16:86904635-86904657
Sequence CCCAGCACACAGGTATCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141887790_1141887795 1 Left 1141887790 16:86904611-86904633 CCTGGTTTGGCTGTTATGTGACC No data
Right 1141887795 16:86904635-86904657 CCCAGCACACAGGTATCTCTGGG No data
1141887785_1141887795 30 Left 1141887785 16:86904582-86904604 CCACAACTGCAGGATTTGTGCTG No data
Right 1141887795 16:86904635-86904657 CCCAGCACACAGGTATCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141887795 Original CRISPR CCCAGCACACAGGTATCTCT GGG Intergenic
No off target data available for this crispr