ID: 1141888921

View in Genome Browser
Species Human (GRCh38)
Location 16:86913422-86913444
Sequence ACTAGGCTGTAACGCAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141888914_1141888921 1 Left 1141888914 16:86913398-86913420 CCCTAGAGTGTGCCAATCACCCC No data
Right 1141888921 16:86913422-86913444 ACTAGGCTGTAACGCAGTTGAGG No data
1141888913_1141888921 14 Left 1141888913 16:86913385-86913407 CCTTATCTGAACTCCCTAGAGTG No data
Right 1141888921 16:86913422-86913444 ACTAGGCTGTAACGCAGTTGAGG No data
1141888915_1141888921 0 Left 1141888915 16:86913399-86913421 CCTAGAGTGTGCCAATCACCCCA No data
Right 1141888921 16:86913422-86913444 ACTAGGCTGTAACGCAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141888921 Original CRISPR ACTAGGCTGTAACGCAGTTG AGG Intergenic
No off target data available for this crispr