ID: 1141890554

View in Genome Browser
Species Human (GRCh38)
Location 16:86924103-86924125
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141890554_1141890561 24 Left 1141890554 16:86924103-86924125 CCAGTACCCTCAAAAATGCCTCA No data
Right 1141890561 16:86924150-86924172 GCGCCCAGATCTCCTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141890554 Original CRISPR TGAGGCATTTTTGAGGGTAC TGG (reversed) Intergenic
No off target data available for this crispr