ID: 1141890556

View in Genome Browser
Species Human (GRCh38)
Location 16:86924110-86924132
Sequence TGCATTGTGAGGCATTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141890556_1141890561 17 Left 1141890556 16:86924110-86924132 CCTCAAAAATGCCTCACAATGCA No data
Right 1141890561 16:86924150-86924172 GCGCCCAGATCTCCTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141890556 Original CRISPR TGCATTGTGAGGCATTTTTG AGG (reversed) Intergenic
No off target data available for this crispr