ID: 1141890557

View in Genome Browser
Species Human (GRCh38)
Location 16:86924121-86924143
Sequence TGCTGGTGGGTTGCATTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141890557_1141890565 26 Left 1141890557 16:86924121-86924143 CCTCACAATGCAACCCACCAGCA No data
Right 1141890565 16:86924170-86924192 AGGCAGCCAGACCCAGCCTGTGG No data
1141890557_1141890561 6 Left 1141890557 16:86924121-86924143 CCTCACAATGCAACCCACCAGCA No data
Right 1141890561 16:86924150-86924172 GCGCCCAGATCTCCTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141890557 Original CRISPR TGCTGGTGGGTTGCATTGTG AGG (reversed) Intergenic
No off target data available for this crispr