ID: 1141890558

View in Genome Browser
Species Human (GRCh38)
Location 16:86924134-86924156
Sequence TGGGCGCATTTGCTGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141890558_1141890561 -7 Left 1141890558 16:86924134-86924156 CCCACCAGCAGCAAATGCGCCCA No data
Right 1141890561 16:86924150-86924172 GCGCCCAGATCTCCTACTTCAGG No data
1141890558_1141890565 13 Left 1141890558 16:86924134-86924156 CCCACCAGCAGCAAATGCGCCCA No data
Right 1141890565 16:86924170-86924192 AGGCAGCCAGACCCAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141890558 Original CRISPR TGGGCGCATTTGCTGCTGGT GGG (reversed) Intergenic
No off target data available for this crispr