ID: 1141890561

View in Genome Browser
Species Human (GRCh38)
Location 16:86924150-86924172
Sequence GCGCCCAGATCTCCTACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141890556_1141890561 17 Left 1141890556 16:86924110-86924132 CCTCAAAAATGCCTCACAATGCA No data
Right 1141890561 16:86924150-86924172 GCGCCCAGATCTCCTACTTCAGG No data
1141890558_1141890561 -7 Left 1141890558 16:86924134-86924156 CCCACCAGCAGCAAATGCGCCCA No data
Right 1141890561 16:86924150-86924172 GCGCCCAGATCTCCTACTTCAGG No data
1141890559_1141890561 -8 Left 1141890559 16:86924135-86924157 CCACCAGCAGCAAATGCGCCCAG No data
Right 1141890561 16:86924150-86924172 GCGCCCAGATCTCCTACTTCAGG No data
1141890554_1141890561 24 Left 1141890554 16:86924103-86924125 CCAGTACCCTCAAAAATGCCTCA No data
Right 1141890561 16:86924150-86924172 GCGCCCAGATCTCCTACTTCAGG No data
1141890555_1141890561 18 Left 1141890555 16:86924109-86924131 CCCTCAAAAATGCCTCACAATGC No data
Right 1141890561 16:86924150-86924172 GCGCCCAGATCTCCTACTTCAGG No data
1141890557_1141890561 6 Left 1141890557 16:86924121-86924143 CCTCACAATGCAACCCACCAGCA No data
Right 1141890561 16:86924150-86924172 GCGCCCAGATCTCCTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141890561 Original CRISPR GCGCCCAGATCTCCTACTTC AGG Intergenic
No off target data available for this crispr