ID: 1141890565

View in Genome Browser
Species Human (GRCh38)
Location 16:86924170-86924192
Sequence AGGCAGCCAGACCCAGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141890562_1141890565 -6 Left 1141890562 16:86924153-86924175 CCCAGATCTCCTACTTCAGGCAG No data
Right 1141890565 16:86924170-86924192 AGGCAGCCAGACCCAGCCTGTGG No data
1141890559_1141890565 12 Left 1141890559 16:86924135-86924157 CCACCAGCAGCAAATGCGCCCAG No data
Right 1141890565 16:86924170-86924192 AGGCAGCCAGACCCAGCCTGTGG No data
1141890560_1141890565 9 Left 1141890560 16:86924138-86924160 CCAGCAGCAAATGCGCCCAGATC No data
Right 1141890565 16:86924170-86924192 AGGCAGCCAGACCCAGCCTGTGG No data
1141890557_1141890565 26 Left 1141890557 16:86924121-86924143 CCTCACAATGCAACCCACCAGCA No data
Right 1141890565 16:86924170-86924192 AGGCAGCCAGACCCAGCCTGTGG No data
1141890558_1141890565 13 Left 1141890558 16:86924134-86924156 CCCACCAGCAGCAAATGCGCCCA No data
Right 1141890565 16:86924170-86924192 AGGCAGCCAGACCCAGCCTGTGG No data
1141890563_1141890565 -7 Left 1141890563 16:86924154-86924176 CCAGATCTCCTACTTCAGGCAGC No data
Right 1141890565 16:86924170-86924192 AGGCAGCCAGACCCAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141890565 Original CRISPR AGGCAGCCAGACCCAGCCTG TGG Intergenic
No off target data available for this crispr