ID: 1141892584

View in Genome Browser
Species Human (GRCh38)
Location 16:86936463-86936485
Sequence AGGCGAGCGGCCACAGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141892584_1141892591 17 Left 1141892584 16:86936463-86936485 CCTAACCCTGTGGCCGCTCGCCT No data
Right 1141892591 16:86936503-86936525 CAGACTCTGTGCTCTGGACATGG No data
1141892584_1141892593 29 Left 1141892584 16:86936463-86936485 CCTAACCCTGTGGCCGCTCGCCT No data
Right 1141892593 16:86936515-86936537 TCTGGACATGGACGTGACATGGG No data
1141892584_1141892592 28 Left 1141892584 16:86936463-86936485 CCTAACCCTGTGGCCGCTCGCCT No data
Right 1141892592 16:86936514-86936536 CTCTGGACATGGACGTGACATGG No data
1141892584_1141892590 11 Left 1141892584 16:86936463-86936485 CCTAACCCTGTGGCCGCTCGCCT No data
Right 1141892590 16:86936497-86936519 AGAGCACAGACTCTGTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141892584 Original CRISPR AGGCGAGCGGCCACAGGGTT AGG (reversed) Intergenic
No off target data available for this crispr