ID: 1141892585

View in Genome Browser
Species Human (GRCh38)
Location 16:86936468-86936490
Sequence CATGAAGGCGAGCGGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141892585_1141892592 23 Left 1141892585 16:86936468-86936490 CCCTGTGGCCGCTCGCCTTCATG No data
Right 1141892592 16:86936514-86936536 CTCTGGACATGGACGTGACATGG No data
1141892585_1141892591 12 Left 1141892585 16:86936468-86936490 CCCTGTGGCCGCTCGCCTTCATG No data
Right 1141892591 16:86936503-86936525 CAGACTCTGTGCTCTGGACATGG No data
1141892585_1141892590 6 Left 1141892585 16:86936468-86936490 CCCTGTGGCCGCTCGCCTTCATG No data
Right 1141892590 16:86936497-86936519 AGAGCACAGACTCTGTGCTCTGG No data
1141892585_1141892593 24 Left 1141892585 16:86936468-86936490 CCCTGTGGCCGCTCGCCTTCATG No data
Right 1141892593 16:86936515-86936537 TCTGGACATGGACGTGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141892585 Original CRISPR CATGAAGGCGAGCGGCCACA GGG (reversed) Intergenic
No off target data available for this crispr