ID: 1141892592

View in Genome Browser
Species Human (GRCh38)
Location 16:86936514-86936536
Sequence CTCTGGACATGGACGTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141892583_1141892592 29 Left 1141892583 16:86936462-86936484 CCCTAACCCTGTGGCCGCTCGCC No data
Right 1141892592 16:86936514-86936536 CTCTGGACATGGACGTGACATGG No data
1141892586_1141892592 22 Left 1141892586 16:86936469-86936491 CCTGTGGCCGCTCGCCTTCATGG No data
Right 1141892592 16:86936514-86936536 CTCTGGACATGGACGTGACATGG No data
1141892584_1141892592 28 Left 1141892584 16:86936463-86936485 CCTAACCCTGTGGCCGCTCGCCT No data
Right 1141892592 16:86936514-86936536 CTCTGGACATGGACGTGACATGG No data
1141892588_1141892592 15 Left 1141892588 16:86936476-86936498 CCGCTCGCCTTCATGGTGATCAG No data
Right 1141892592 16:86936514-86936536 CTCTGGACATGGACGTGACATGG No data
1141892585_1141892592 23 Left 1141892585 16:86936468-86936490 CCCTGTGGCCGCTCGCCTTCATG No data
Right 1141892592 16:86936514-86936536 CTCTGGACATGGACGTGACATGG No data
1141892589_1141892592 8 Left 1141892589 16:86936483-86936505 CCTTCATGGTGATCAGAGCACAG No data
Right 1141892592 16:86936514-86936536 CTCTGGACATGGACGTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141892592 Original CRISPR CTCTGGACATGGACGTGACA TGG Intergenic
No off target data available for this crispr