ID: 1141894050

View in Genome Browser
Species Human (GRCh38)
Location 16:86947196-86947218
Sequence CTGGTGTCCTTGGCCACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141894036_1141894050 20 Left 1141894036 16:86947153-86947175 CCGCTCCACCTGTTGGTCCAAAC No data
Right 1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG No data
1141894039_1141894050 3 Left 1141894039 16:86947170-86947192 CCAAACCAGCCCCATGTTCCCTC No data
Right 1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG No data
1141894040_1141894050 -2 Left 1141894040 16:86947175-86947197 CCAGCCCCATGTTCCCTCCTCCT No data
Right 1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG No data
1141894042_1141894050 -6 Left 1141894042 16:86947179-86947201 CCCCATGTTCCCTCCTCCTGGTG No data
Right 1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG No data
1141894033_1141894050 25 Left 1141894033 16:86947148-86947170 CCCTCCCGCTCCACCTGTTGGTC No data
Right 1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG No data
1141894037_1141894050 15 Left 1141894037 16:86947158-86947180 CCACCTGTTGGTCCAAACCAGCC No data
Right 1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG No data
1141894043_1141894050 -7 Left 1141894043 16:86947180-86947202 CCCATGTTCCCTCCTCCTGGTGT No data
Right 1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG No data
1141894035_1141894050 21 Left 1141894035 16:86947152-86947174 CCCGCTCCACCTGTTGGTCCAAA No data
Right 1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG No data
1141894034_1141894050 24 Left 1141894034 16:86947149-86947171 CCTCCCGCTCCACCTGTTGGTCC No data
Right 1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG No data
1141894038_1141894050 12 Left 1141894038 16:86947161-86947183 CCTGTTGGTCCAAACCAGCCCCA No data
Right 1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG No data
1141894044_1141894050 -8 Left 1141894044 16:86947181-86947203 CCATGTTCCCTCCTCCTGGTGTC No data
Right 1141894050 16:86947196-86947218 CTGGTGTCCTTGGCCACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141894050 Original CRISPR CTGGTGTCCTTGGCCACCTC AGG Intergenic
No off target data available for this crispr