ID: 1141896236

View in Genome Browser
Species Human (GRCh38)
Location 16:86960338-86960360
Sequence TGTGCTCCACGAAGCGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141896236_1141896243 3 Left 1141896236 16:86960338-86960360 CCCCCAGCGCTTCGTGGAGCACA No data
Right 1141896243 16:86960364-86960386 AAGACTGGTAGGATGGACAGTGG No data
1141896236_1141896242 -4 Left 1141896236 16:86960338-86960360 CCCCCAGCGCTTCGTGGAGCACA No data
Right 1141896242 16:86960357-86960379 CACAGAGAAGACTGGTAGGATGG No data
1141896236_1141896241 -8 Left 1141896236 16:86960338-86960360 CCCCCAGCGCTTCGTGGAGCACA No data
Right 1141896241 16:86960353-86960375 GGAGCACAGAGAAGACTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141896236 Original CRISPR TGTGCTCCACGAAGCGCTGG GGG (reversed) Intergenic
No off target data available for this crispr