ID: 1141897294

View in Genome Browser
Species Human (GRCh38)
Location 16:86966230-86966252
Sequence CAGTGGAAGCTGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141897294_1141897303 1 Left 1141897294 16:86966230-86966252 CCTTCCTCCTCCAGCTTCCACTG No data
Right 1141897303 16:86966254-86966276 CCCAGGTGTTCCTCGGCTTGTGG No data
1141897294_1141897301 -6 Left 1141897294 16:86966230-86966252 CCTTCCTCCTCCAGCTTCCACTG No data
Right 1141897301 16:86966247-86966269 CCACTGGCCCAGGTGTTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141897294 Original CRISPR CAGTGGAAGCTGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr