ID: 1141897897

View in Genome Browser
Species Human (GRCh38)
Location 16:86970360-86970382
Sequence CACTCCCTCCAGAGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141897897_1141897903 11 Left 1141897897 16:86970360-86970382 CCCTAGAGCCTCTGGAGGGAGTG No data
Right 1141897903 16:86970394-86970416 ACAGCTTGATTTCAGACTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141897897 Original CRISPR CACTCCCTCCAGAGGCTCTA GGG (reversed) Intergenic
No off target data available for this crispr