ID: 1141901479

View in Genome Browser
Species Human (GRCh38)
Location 16:86993944-86993966
Sequence GCGCCCTGGACAACCTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141901474_1141901479 -1 Left 1141901474 16:86993922-86993944 CCTGACTTGCCACTGAACCCATG No data
Right 1141901479 16:86993944-86993966 GCGCCCTGGACAACCTCCCAAGG No data
1141901476_1141901479 -10 Left 1141901476 16:86993931-86993953 CCACTGAACCCATGCGCCCTGGA No data
Right 1141901479 16:86993944-86993966 GCGCCCTGGACAACCTCCCAAGG No data
1141901473_1141901479 2 Left 1141901473 16:86993919-86993941 CCTCCTGACTTGCCACTGAACCC No data
Right 1141901479 16:86993944-86993966 GCGCCCTGGACAACCTCCCAAGG No data
1141901472_1141901479 8 Left 1141901472 16:86993913-86993935 CCTGCTCCTCCTGACTTGCCACT No data
Right 1141901479 16:86993944-86993966 GCGCCCTGGACAACCTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141901479 Original CRISPR GCGCCCTGGACAACCTCCCA AGG Intergenic
No off target data available for this crispr